View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21237_high_4 (Length: 442)
Name: NF21237_high_4
Description: NF21237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21237_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 20 - 317
Target Start/End: Complemental strand, 51823636 - 51823339
Alignment:
| Q |
20 |
atgatttcactataatctttatcttaggaatttgagctctttaccttttttgtattgtttttccactttgcaaaggttgtttttcagccttccatggttt |
119 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51823636 |
atgatttcactataatctttatctttagtatttgagctctttcccttttttgtattgtttttccactttgcaaaggttgtttttcagccttccatggttt |
51823537 |
T |
 |
| Q |
120 |
cctcttcaattgcaccaactataaagtaaaagggagcaaaacataattgagaacttactaactaactttattgctttctatacttctttatatagtacag |
219 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51823536 |
cctcttcaattgcaccatctgtaaagtaaaagggagcaaaacataattgagaactaactaactaactttattgctttctatacttctttatatagtacag |
51823437 |
T |
 |
| Q |
220 |
gtgatcaaaggcccaattacattttaggttaattaccagaatattgaattactctactaacattagagaatgaaatactttcataattgcaactgaac |
317 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51823436 |
gtgatcaaaggctcaagtacattttaggttaattaccagaatattgaattactctactaacattagagaatgaaatactttcataattgcaactgaac |
51823339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University