View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21237_high_5 (Length: 402)
Name: NF21237_high_5
Description: NF21237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21237_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 374; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 1 - 386
Target Start/End: Original strand, 28032403 - 28032788
Alignment:
| Q |
1 |
tgatcaaactcttacccactatgtgtctcaatggcttcaagctgtcgcaaaatgaaccataaccaataggttgttatgtgccctggaactagtgctggtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28032403 |
tgatcaaactcttacccactatgtgtctcaatggcttcaagctgtcgcaaaatgaaccataaccaataggttgttatgtgccctggaactagtgctggtc |
28032502 |
T |
 |
| Q |
101 |
caagaaatgcagggaaacctagtatcaaaatctcagaccaatgggcataaggtgctgcaagtgcaataggtgttttgtattcatggtgaaccttgtggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28032503 |
caagaaatgcagggaaacctagtatcaaaatctcagaccaatgggcataaggagctgcaagtgcaataggtgttttgtattcatggtgaaccttgtggat |
28032602 |
T |
 |
| Q |
201 |
attatcaaatgcccatttgttatggagcatcctatggaaccagtaatttacataatcttcaataataacgtaaactattaggtgccaaaacaactcccag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28032603 |
gttatcaaatgcccatttgttatggagcatcctatggaaccagtaatttacataatcttcaataataacgtaaactattaggtgccaaaacaactcccag |
28032702 |
T |
 |
| Q |
301 |
cctgatggcaatggcaaacctgttctaatcccaagccactgaacaaaatttatggtaaaaaactaataaatccgcagtcaatattt |
386 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28032703 |
ccagatggcaatggcaaacctgttctaatcccaagccactgaacaaaatttatggtaaaaaactaataaatccgcagtcaatattt |
28032788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University