View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21237_low_5 (Length: 423)
Name: NF21237_low_5
Description: NF21237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21237_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 155 - 405
Target Start/End: Original strand, 41705459 - 41705709
Alignment:
| Q |
155 |
cttcaacctcggaccccactcccaacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705459 |
cttcaacctcggaccccactcccaacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgt |
41705558 |
T |
|
| Q |
255 |
gaattaaaacccaagcttacctcggatccctctccccctaccaacatctcccacagcacccccatttcatgcaactcccatgcatgctctgtagcacaca |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705559 |
gaattaaaacccaagcttacctcggatccctctccccctaccaacatctcccacagcacccccatttcatgcaactcccatgcatgctctgtagcacaca |
41705658 |
T |
|
| Q |
355 |
gttccaccccctcttccgatctatgcacaatggctcattgccctttagact |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705659 |
gttccaccccctcttccgatctatgcacaatggctcattgccctttagact |
41705709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 21 - 95
Target Start/End: Original strand, 41705325 - 41705399
Alignment:
| Q |
21 |
atagaattcaacacaacccaccacctccttaaatccacctcaactcactcattatcacgcttccaccgccataaa |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705325 |
atagaattcaacacaacccaccacctccttaaatccacctcaactcactcattatcacgcttccaccgccataaa |
41705399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 177 - 257
Target Start/End: Complemental strand, 3744418 - 3744338
Alignment:
| Q |
177 |
caacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgtgaa |
257 |
Q |
| |
|
|||| |||||| ||||||||||||||||| || ||||||||||||||||| || |||| ||| | ||||| ||||||||| |
|
|
| T |
3744418 |
caactcataacactctacatggacacaggtagcgaccttgtttggttcccttgttcacctttcgaatgcattctctgtgaa |
3744338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University