View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21237_low_9 (Length: 256)
Name: NF21237_low_9
Description: NF21237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21237_low_9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 70 - 256
Target Start/End: Complemental strand, 26926412 - 26926226
Alignment:
| Q |
70 |
gacatgaattaattattatttttacaaccattccgcgagagaagttgaactctatcattcaagttactaaatcaatcaatctattttcacctaaacttgt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26926412 |
gacatgaattaattattatttttacaaccattccgcgagagaagttgaactctatccttcaagttactaaatcaatcaatctattttcacctaaacttgt |
26926313 |
T |
|
| Q |
170 |
gactttgagattgaaaatcacttgatataaatttgaacattgattcttatcaccatatgtagttatatatattgttttcttttcttt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26926312 |
gactttgagattgaaaatcacttgatataaatttgaacattgattcttatcaccatatgtagttatatatattgttttcttttcttt |
26926226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University