View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21238_high_4 (Length: 428)
Name: NF21238_high_4
Description: NF21238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21238_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 8 - 395
Target Start/End: Original strand, 34908800 - 34909200
Alignment:
| Q |
8 |
agagaagaattagataccttattcggttttgaaaagagtgtgttgtatggcgcaattgaattgaatctaacagagtatctaccaactccctgacctcacc |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| ||||||| |||| ||||||||||||||||||||| |
|
|
| T |
34908800 |
agagaagaattagataccttattccgttttgaaaagagtgtgttgtgtggcgcaattgaat-----ctaacagtgtatttaccaactccctgacctcacc |
34908894 |
T |
 |
| Q |
108 |
aaacattgttg---ctggtgccggactacacgagggatattctttcccttaaacttccaaacactcgcccccgagagagac---------------gaga |
189 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |
|
|
| T |
34908895 |
aaacattgttgttgctggtggcggactacacgagggatattctttcccttaaacttcaaaacactcgcccccgagaaagagagagagagagagagagaga |
34908994 |
T |
 |
| Q |
190 |
caactcactttccacttcacacaacattcagattttcccttctcttccattttccgtttcaaatctcaaaaatgcagtccacagccttcactctctcccc |
289 |
Q |
| |
|
| ||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34908995 |
cgactcactttccacttcaaacaacattcagattttcctttctcttccattttccgtttcaaatctccaaaatgcagtccacagccttcactctctcccc |
34909094 |
T |
 |
| Q |
290 |
taccctccctctccacaccaaccccaaccgtttcagacgctcccttaacctccgtctctccgccgccaaatctaacaacaacggcggcggcgtaaatcac |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34909095 |
taccctccctctccacaccaaccccaaccgtttcagacgatcccttaacctccgtctctccgccgccaaatctaacaacaacgacggcggcgtaaatcac |
34909194 |
T |
 |
| Q |
390 |
aatggc |
395 |
Q |
| |
|
|||||| |
|
|
| T |
34909195 |
aatggc |
34909200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 300 - 341
Target Start/End: Original strand, 34351923 - 34351964
Alignment:
| Q |
300 |
ctccacaccaaccccaaccgtttcagacgctcccttaacctc |
341 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| ||||||||| |
|
|
| T |
34351923 |
ctccacaccaaccccaaccatttcagatgctcacttaacctc |
34351964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University