View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21239_high_10 (Length: 451)
Name: NF21239_high_10
Description: NF21239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21239_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-125; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 10 - 245
Target Start/End: Original strand, 4294419 - 4294654
Alignment:
| Q |
10 |
cataggtagaaacagaactgctttgtttagctgtgatcattagtgacaaagaaacaacagaacttcccatgcataaacctcgaagaatcagcagcatcac |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4294419 |
catagatagaaacagaactgctttgtttagctgtgatcattagtgacaaagaaacaacagaacttcccatgcataaacctcgaagaatcagcagcatcac |
4294518 |
T |
|
| Q |
110 |
ctccgttctccggcgtcgattgttcttctcgccgtctccgacaagaggaccactcattcttgttgatccactgcactctaaagctgctggtttctgctca |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4294519 |
ctccgttctccggcgtcgattggtcttctcgccgtctccgacaagaggaccactcattcttgttgatccactgcactctaaagctgctggtttctgctca |
4294618 |
T |
|
| Q |
210 |
ctcaccatgatctcttggaggagctctaccttatgc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4294619 |
ctcaccatgatctcttggaggagctctaccttatgc |
4294654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 292 - 436
Target Start/End: Original strand, 4294699 - 4294838
Alignment:
| Q |
292 |
tatatgaagggtatgaaagggtgagttaggaggtgacggtgggattgattgagagcttcctttcggaacattttgtatatctatattattatattcctaa |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |||||||||||||| |
|
|
| T |
4294699 |
tatatgaagggtatgaaagggtgagttaggaggtgacggtgggattgattgagagcttccttttggaacattttgtacat-----atattatattcctaa |
4294793 |
T |
|
| Q |
392 |
acttttgtacataaatttttatggtttgtttttgttatatgattt |
436 |
Q |
| |
|
| || |||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
4294794 |
atgcttatacataaatttttatggtttacttttgttatattattt |
4294838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University