View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21239_high_49 (Length: 212)

Name: NF21239_high_49
Description: NF21239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21239_high_49
NF21239_high_49
[»] chr7 (1 HSPs)
chr7 (109-177)||(32860893-32860961)


Alignment Details
Target: chr7 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 109 - 177
Target Start/End: Complemental strand, 32860961 - 32860893
Alignment:
109 ggaaccgccacatcagccagtggcttcagttcgagtggatcggtggttagttagggttttgtatttgag 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32860961 ggaaccgccacatcagccagtggcttcagttcgagtggatcggtggttagttagggttttgtatttgag 32860893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University