View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21239_low_20 (Length: 402)
Name: NF21239_low_20
Description: NF21239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21239_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 10 - 387
Target Start/End: Complemental strand, 22653608 - 22653231
Alignment:
| Q |
10 |
attatactcatttggttcaaatatccactcctttgccctattttgatcgggccgcgtacacggttcggttaatgggaattagggtttcggagaagttact |
109 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22653608 |
attatactcctttggttcaaatatccactcctttgccctattttgatcgggccgcgtacacagttcggttaatgggaattagggtttcagagaagttact |
22653509 |
T |
|
| Q |
110 |
taatttgtctagtgatatgctcgctccagatcatactggagcaggtcaaactatgtttgatttaggtactcagtttacgttcttacttgggccggtttat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22653508 |
taatttgtctagtgatatgctcgctccagatcatactggagcgggtcaaactatgtttgatttgggtactcagtttacattcttacttgggccggtttat |
22653409 |
T |
|
| Q |
210 |
agtgtgttgagagaagagtttcttaatcaaacaaataatactttacgggtattggatgatccgaattttgcatttcaagtagcaatggatctttgttatc |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22653408 |
agtgtgttgagagaagagtttcttaatcaaacaaatagtactttacaggtattggatgatccgaattttgcatttcaagtagcaatggatctttgttatc |
22653309 |
T |
|
| Q |
310 |
gggttccattgaaccaatcaaaattacccgagttgccaagtgttagtttagtatttgatggagccgagatgagggttt |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22653308 |
gggttccattgaaccaatcaaaattacccgagttgccaagtgttagtttagtatttgatggagtcgagatgagggttt |
22653231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University