View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21239_low_27 (Length: 324)
Name: NF21239_low_27
Description: NF21239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21239_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 18 - 316
Target Start/End: Original strand, 38568890 - 38569188
Alignment:
| Q |
18 |
aaagatttacgcgccggtgttgctttatgtgcacgcgctgcatttctcggtcacatcgacggtttacgtgagcttggtcattgtttacaagacggttacg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38568890 |
aaagatttacgcgccggtgttgctttatgtgcacgcgctgcatttctcggtcacatcgacggtttacgtgagcttggtcattgtttacaagacggttacg |
38568989 |
T |
 |
| Q |
118 |
gtgttaaacagaacgttattgaaggtcggcggtttctagtccaagcaaacgcacgtgaactcgctgccgttttatctaacggcaataacaacaaacaacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38568990 |
gtgttaaacagaacgttattgaaggtcgacggtttctagtccaagcaaacgcacgtgaactcgctgccgttttatctaacggcaataacaacaaacaacc |
38569089 |
T |
 |
| Q |
218 |
gttgctgacgtggagtgttaacccgggttcaagccaacctccacagcttcgtgttttagctggtgctggttctgtttctggttcgggttgtcctttgct |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38569090 |
gttgctgacgtggagtgttaacccgggttcaagccaacctccacagcttcgtgttttagctggtgctggttctgtttctggttcgggttgtcctttgct |
38569188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 60 - 130
Target Start/End: Complemental strand, 34683703 - 34683633
Alignment:
| Q |
60 |
tttctcggtcacatcgacggtttacgtgagcttggtcattgtttacaagacggttacggtgttaaacagaa |
130 |
Q |
| |
|
|||||||| |||||||||| | ||||||||||| || ||||||||||||||||||||||| || ||||| |
|
|
| T |
34683703 |
tttctcggccacatcgacgcacttcgtgagcttggacactgtttacaagacggttacggtgtcaagcagaa |
34683633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University