View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21239_low_42 (Length: 238)
Name: NF21239_low_42
Description: NF21239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21239_low_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 16697599 - 16697396
Alignment:
| Q |
17 |
gaagagatagcttgaaaaatggtgatgataacttgaaatttgggttagagatatttggttttaggttatgaggcatgaaaggaggaacatcaaggaatgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16697599 |
gaagagatagcttgaaaaatggtgataataacttgaaatttgggttagagatatttagttttaggttatgaggcatgaaaggaggaacatcaaggaatgt |
16697500 |
T |
|
| Q |
117 |
gtctgtgaagtgggagtgaattaggcccactttgtcacttaaaaagcaaaaatggtaaccctttattttggggagaatgatatttatgcttttatcaatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16697499 |
gtctgtgaagtgggagtgaattaggcccactttgtcacttaaaaagcaaaaatggtaaccctttattttggggagaatgatatttatgcttttatcaatg |
16697400 |
T |
|
| Q |
217 |
aaaa |
220 |
Q |
| |
|
|||| |
|
|
| T |
16697399 |
aaaa |
16697396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University