View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21239_low_51 (Length: 215)
Name: NF21239_low_51
Description: NF21239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21239_low_51 |
 | |
|
| [»] scaffold0013 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0013 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 28 - 202
Target Start/End: Original strand, 53584 - 53757
Alignment:
| Q |
28 |
ataattcttgtagtggggtggtctcatctcggtttaaatagatagagtactacttgtacttcatctattcctttaagtctagtattaattgtacatcatt |
127 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53584 |
ataactcttgtagtggg-tggtctcatctcggtttaaatggatagagtactacttgtacttcatctattcctttaagtctagtattaattgtacatcatt |
53682 |
T |
|
| Q |
128 |
tttaactatgattcaacaaattttaatttgttgaatcatataagaaaacatgttttgtttgctgagggaatgata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
53683 |
tttaactatgattcaacaaattttaatttgttgaatcatataagaaaacatgttttgtttgctgaggggatgata |
53757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University