View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2123_high_7 (Length: 222)
Name: NF2123_high_7
Description: NF2123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2123_high_7 |
 |  |
|
| [»] scaffold0479 (1 HSPs) |
 |  |  |
|
| [»] scaffold0519 (2 HSPs) |
 |  |  |
|
| [»] scaffold0210 (1 HSPs) |
 |  |  |
|
| [»] scaffold0692 (2 HSPs) |
 |  |  |
|
| [»] scaffold0766 (1 HSPs) |
 |  |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0181 (1 HSPs) |
 |  |  |
|
| [»] scaffold0129 (1 HSPs) |
 |  |  |
|
| [»] scaffold0048 (2 HSPs) |
 |  |  |
|
| [»] scaffold0083 (1 HSPs) |
 |  |  |
|
| [»] scaffold0729 (1 HSPs) |
 |  |  |
|
| [»] scaffold0092 (2 HSPs) |
 |  |  |
|
| [»] scaffold0481 (1 HSPs) |
 |  |  |
|
| [»] scaffold0400 (1 HSPs) |
 |  |  |
|
| [»] scaffold0365 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
| [»] scaffold0047 (1 HSPs) |
 |  |  |
|
| [»] scaffold0041 (2 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0459 (2 HSPs) |
 |  |  |
|
| [»] scaffold0366 (3 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold0434 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0029 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0479 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: scaffold0479
Description:
Target: scaffold0479; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 110 - 212
Target Start/End: Complemental strand, 11912 - 11810
Alignment:
| Q |
110 |
caatgtgtaagaagttttggatacaaaaactttggattcacatcctttttgccttgtcatgcaaaactctctgcacatcctgtaatggaccattcatctc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
11912 |
caatgtgtaagaagttttggatacaaaaactttggattcacatcctttttgccttgtcatgcaaaactctctgcacatcctgtaatggaccatccttctc |
11813 |
T |
 |
| Q |
210 |
agt |
212 |
Q |
| |
|
||| |
|
|
| T |
11812 |
agt |
11810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 87; Significance: 7e-42; HSPs: 104)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 110 - 212
Target Start/End: Original strand, 12722259 - 12722361
Alignment:
| Q |
110 |
caatgtgtaagaagttttggatacaaaaactttggattcacatcctttttgccttgtcatgcaaaactctctgcacatcctgtaatggaccattcatctc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| | |||| |
|
|
| T |
12722259 |
caatgtgtaagaagttttggatacaaaaactttggattcacatcctttttgccttgtcatacaaaactctctgcacattctgtaatggaccatccttctc |
12722358 |
T |
 |
| Q |
210 |
agt |
212 |
Q |
| |
|
||| |
|
|
| T |
12722359 |
agt |
12722361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 20327639 - 20327731
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| ||||| | |||||||||| | |||||||| |
|
|
| T |
20327639 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcctatccgatgtgggattcttaaca |
20327731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 4155383 - 4155289
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||| |||| ||| ||||||| |||||||||| |||||||||||| |
|
|
| T |
4155383 |
acaaccccacaaaaccggcttttgaggtgaggattgcccccacttataaacacgctgtctggccatgtcatatccgatgtgggactcttaacaat |
4155289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 16926974 - 16927068
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| || |||||||||||||||||||||||| |||| | |||||||||| |||||||||||| |
|
|
| T |
16926974 |
acaaccccacaaaaccggcttgtgagatgaggattacccccacttataaacacattgtcaggccatgttctatccgatgtgggactcttaacaat |
16927068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 16239650 - 16239558
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||| | ||||||||| |||||||||| |
|
|
| T |
16239650 |
acaatcccacaaaaccggcttgtgaggtgaggtttgcccccacttataaacacattgtcaggccatgtcctatccgatgtgagactcttaaca |
16239558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 20303089 - 20303181
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||| ||||||| |||||||||| | |||||||| |
|
|
| T |
20303089 |
acaatcccacaaaaccggtttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcatatccgatgtgggattcttaaca |
20303181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 35038219 - 35038311
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| || | | |||||||||| |||||||||| |
|
|
| T |
35038219 |
acaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca |
35038311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 54567951 - 54567859
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| | |||||| | | |||||||||| |
|
|
| T |
54567951 |
acaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcaggccatgtcctatccgatataggactcttaaca |
54567859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 20327874 - 20327967
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| ||||||||||| |
|
|
| T |
20327874 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaacaa |
20327967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 31317287 - 31317196
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| || || ||||| | |||||||||| |||||||||| |
|
|
| T |
31317287 |
acaatcccacaaaaccggcttgtgaggtgaggattgcc-ccacttataaacacattgccatgctatgtcttatccgatgtgggactcttaaca |
31317196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 35038453 - 35038545
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||| |||||||||||||||||||||||| || | | |||||||||| |||||||||| |
|
|
| T |
35038453 |
acaaccccacaaaaccagcttgtcaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca |
35038545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 18 - 113
Target Start/End: Original strand, 6487357 - 6487452
Alignment:
| Q |
18 |
aacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| | || | ||||||||| |||||||||||| |
|
|
| T |
6487357 |
aacaaccccataaaaccggcttgtgaggtgaggattacctccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaacaat |
6487452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 110 - 212
Target Start/End: Original strand, 12715037 - 12715140
Alignment:
| Q |
110 |
caatgtgtaagaagttttggatacaaaaactttggattcacatcctttttgccttgtcatgcaaaactctct-gcacatcctgtaatggaccattcatct |
208 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||| |||| |||||||||||||| ||||||||||||| ||| ||||||||||||| ||||||| | ||| |
|
|
| T |
12715037 |
caatttgtaaggagttttggatacaaaaactttagatttgcatcctttttgcctcgtcatgcaaaactgtctggcacatcctgtaacggaccatccttct |
12715136 |
T |
 |
| Q |
209 |
cagt |
212 |
Q |
| |
|
|||| |
|
|
| T |
12715137 |
cagt |
12715140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 1723101 - 1723163
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
1723101 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggc |
1723163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 11589844 - 11589782
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
11589844 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggc |
11589782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 45138827 - 45138908
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| | || || | |||||||||| |
|
|
| T |
45138827 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgccagaccatctcttatccgatgtgg |
45138908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 23691217 - 23691309
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
23691217 |
acaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca |
23691309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 23708017 - 23708109
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
23708017 |
acaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca |
23708109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 23726473 - 23726565
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
23726473 |
acaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca |
23726565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 23744929 - 23745021
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
23744929 |
acaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca |
23745021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 24063454 - 24063546
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
24063454 |
acaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca |
24063546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 39269390 - 39269298
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| | |||| | ||| |||||| |||||||||| |
|
|
| T |
39269390 |
acaatccctcaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtgctctccaatgtgggactcttaaca |
39269298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 54368575 - 54368483
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |||||| || | | || ||||||| |||||||||| |
|
|
| T |
54368575 |
acaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaacacattttcaggccatcttctatcggatgtgggactcttaaca |
54368483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 472085 - 472144
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
472085 |
acaaccccacaaaaccggcttgtgaggtaaggattgcccccacttataaacacattgtca |
472144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 112
Target Start/End: Complemental strand, 34610620 - 34610526
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| || ||||||||||||| |||||||||| | ||||||| ||| ||| ||||||||||| |
|
|
| T |
34610620 |
acaaccccacaaaaccgacttgtgaggtgaggattgccccccacttataaacatattgtcaggccaactcatgtctgatatgggactcttaacaa |
34610526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 45138996 - 45139058
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
45138996 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttattaacacgttgtcaggc |
45139058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 110 - 212
Target Start/End: Original strand, 12709954 - 12710059
Alignment:
| Q |
110 |
caatgtgtaaga-agttttggatacaaaa-actttggattcacatcctttttgccttgtcatgcaaaactctct-gcacatcctgtaatggaccattcat |
206 |
Q |
| |
|
|||||||||||| ||||||||||| |||| |||||||| || |||||||||||||||||||||||||| | || ||||||||||||||||||||| | | |
|
|
| T |
12709954 |
caatgtgtaagagagttttggataaaaaaaactttggactcgcatcctttttgccttgtcatgcaaaaatgcctggcacatcctgtaatggaccatcctt |
12710053 |
T |
 |
| Q |
207 |
ctcagt |
212 |
Q |
| |
|
|||||| |
|
|
| T |
12710054 |
ctcagt |
12710059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 112
Target Start/End: Complemental strand, 22729159 - 22729066
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||| |||||| ||||||||||||||| | || || | |||||||||| ||||| ||||| |
|
|
| T |
22729159 |
acaacctcacaaaaccggcttgtgaagtgaggattgcccccacttgtaaacacattgtcagaccatctcctatccgatgtgggactctgaacaa |
22729066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 4155618 - 4155526
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||| | ||||||||||| |||||||||||||| | |||||||||||||||||||||||| |||| | | |||||||| |||||||||| |
|
|
| T |
4155618 |
acaaccctaaaaaaccggcttttgaggtgaggattgtccccacttataaacacattgtcaggccttgtcctatgcgatgtgggactcttaaca |
4155526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 17638293 - 17638202
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||| ||||||||||||| |||||||||| | || | |||||||||||||||||||| |
|
|
| T |
17638293 |
acaacccctcaaaaccagcttgtgaggtgaggattgcc-ccacttataaacaaattgtcaggccaactcctaaccgatgtggaactcttaaca |
17638202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 27670417 - 27670509
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||| ||||||||||||| ||||||||| | || || ||||||||| |||||||||| |
|
|
| T |
27670417 |
acaaccccacaaaaccggcctttgaggtgaggattgcccccacttataaacaatttgtcaggccaattcctgaccgatgtgggactcttaaca |
27670509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 49629664 - 49629573
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| ||||||||||||||||| ||| || || || | ||| ||||||||||||||||| |
|
|
| T |
49629664 |
acaaccccacaaaaccggtttgtgaggtggggattgccgccacttataaacacattttca-gccatctcctatccaatgtggaactcttaaca |
49629573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 8019027 - 8018965
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||| |
|
|
| T |
8019027 |
acaaccccacaaaaccggcttgtgaggtgaggattgcacccacttataaacaaattttcaggc |
8018965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 9273020 - 9272958
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||| ||| |||||| |
|
|
| T |
9273020 |
acaaccccacaaaaccggcttgtgaggtgagggttgcccccacttataaacaaattatcaggc |
9272958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 39683292 - 39683354
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccac-ttataaacacattgtcagg |
80 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39683292 |
acaatcccacaaaaccgtcttgtgaggtgaggattgcctccactttataaacacattgtcagg |
39683354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 23 - 77
Target Start/End: Original strand, 50083110 - 50083164
Alignment:
| Q |
23 |
ccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtc |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
50083110 |
ccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtc |
50083164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 23708256 - 23708309
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
23708256 |
cacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcag |
23708309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 23726712 - 23726765
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
23726712 |
cacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcag |
23726765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 23745168 - 23745221
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
23745168 |
cacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcag |
23745221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 24063693 - 24063746
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
24063693 |
cacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcag |
24063746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 1800274 - 1800214
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||| ||| |||||| |
|
|
| T |
1800274 |
acaaccccacaaaaccggtttgtgaggtgaggattgcccccacttataaatacactgtcag |
1800214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 9273254 - 9273194
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||| ||||||||||||| |||||||| |
|
|
| T |
9273254 |
acaaccccacaaaaccagcttgtgaagtgaggattgcccccacttataaacaaattgtcag |
9273194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 87
Target Start/End: Complemental strand, 16239886 - 16239818
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtc |
87 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| ||||||||||||| |||||||||| ||||| |
|
|
| T |
16239886 |
acaaccccacaaaaccgacttgtgaggtgagatttgcccccacttataaacatattgtcaggccatgtc |
16239818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 107
Target Start/End: Complemental strand, 45828305 - 45828217
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||| |||||||||||||||| |||||| || | |||||||||||| |||||| |
|
|
| T |
45828305 |
acaaccccacaaaacctgcttgtgaggtggagattgcccccacttataaacacatgttcaggccatcttttgtccgatgtgggactctt |
45828217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 13574946 - 13575000
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
13574946 |
acaaccccacaaaactggcttgtgaggtgaggatttcccccacttataaacacat |
13575000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 50930761 - 50930707
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50930761 |
acaaccccacaaaaccgttttgtgaggtgaggattgcccccacttataaacacat |
50930707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 7697423 - 7697515
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||| |||||||| |||| |||||| || || || | |||||||||| ||||||||||| |
|
|
| T |
7697423 |
acaaccccacaaaaccagcttgtgaggtgatgattgcccccacttat-aacatattgtctggtcatctcctatccgatgtgggactcttaacaa |
7697515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 18757901 - 18757840
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| ||| |||||||||||||||| |||||| |
|
|
| T |
18757901 |
acaaccccacaaaaccgccttgtgatgtgaggatcgcccccacttataaacacatagtcagg |
18757840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 23691456 - 23691509
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
23691456 |
cacaaatccggcttgtgaggtgaggattgcccccacttataaacaaattgtcag |
23691509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 80
Target Start/End: Complemental strand, 43781634 - 43781581
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43781634 |
acaaaaccgacttgtgaagtgaggattgcctccacttataaactcattgtcagg |
43781581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 13741126 - 13741186
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgagga-ttgcctccacttataaacacattgtca |
78 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||| | ||||||||||||||||||||| |
|
|
| T |
13741126 |
acaaccccaaaaaaccggcttgtgaggtgaggatttgtccccacttataaacacattgtca |
13741186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 24866256 - 24866216
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24866256 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctcc |
24866216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 31317525 - 31317433
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||| ||||| ||||||||||||||| |||| | ||||||||||||||||||||| | ||||| | |||||||| | |||||||||| |
|
|
| T |
31317525 |
acaaccccgcaaaatcggcttgtgaggtgatgattttccccacttataaacacattgtcatgtcatgtcctatccgatgtaggactcttaaca |
31317433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 38791475 - 38791567
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||| | |||||||||| |||||||||| | || || | |||||||||| |||||||||| |
|
|
| T |
38791475 |
acaaccccacaaaatcgatttgtgaggtgaggattgtcctcacttataaatacattgtcagaccatctcctatccgatgtgggactcttaaca |
38791567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 8142432 - 8142491
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| | ||||||| | ||||||| |
|
|
| T |
8142432 |
acaacctcacaaaaccggcttgtgaggtgaggattgcctctatttataaatatattgtca |
8142491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 70
Target Start/End: Complemental strand, 45828078 - 45828027
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
45828078 |
acaacctcacaaaaccggcttgtgaggtgaggattgccccaacttataaaca |
45828027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 50052564 - 50052619
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacat |
73 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| || |||||||||||||||| |
|
|
| T |
50052564 |
acaaccccacaaaaccggcttgtgaagtgaggattgccccccacttataaacacat |
50052619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 107
Target Start/End: Original strand, 50052800 - 50052879
Alignment:
| Q |
29 |
aaaaccggcttgtgaggtgaggattgc-ctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
||||||||||||||||| ||||||||| | |||||||||||||||| ||||||| || | |||||||||||| |||||| |
|
|
| T |
50052800 |
aaaaccggcttgtgaggcgaggattgcaccccacttataaacacatggtcaggccatattttgtccgatgtgggactctt |
50052879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 31 - 81
Target Start/End: Complemental strand, 30138111 - 30138061
Alignment:
| Q |
31 |
aaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
30138111 |
aaccggcttatgaggtgaggattgcccccacttataaacacattatcaggc |
30138061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 31 - 81
Target Start/End: Complemental strand, 30147662 - 30147612
Alignment:
| Q |
31 |
aaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
30147662 |
aaccggcttatgaggtgaggattgcccccacttataaacacattatcaggc |
30147612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 12930153 - 12930214
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||| | |||| ||| |||||||||||||| |
|
|
| T |
12930153 |
acaaccccacaaaaccggcttgtgaagtgagaattgtccccacatatgaacacattgtcagg |
12930214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 22 - 79
Target Start/End: Original strand, 17001449 - 17001506
Alignment:
| Q |
22 |
accccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||| || ||| |||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
17001449 |
accccacaaaatcgccttatgaggtgatgattgcccccacttataaacacattgtcag |
17001506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 30179741 - 30179794
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||| | ||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
30179741 |
acaaaactgacttgtgaggtgaggattacccccacttataaacacattgtcagg |
30179794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 39620385 - 39620324
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||||||||| ||||| ||||||| || || || ||||||||||||||||||||||| |
|
|
| T |
39620385 |
acaaccccacaaaactggcttatgaggtgcgggttacccccacttataaacacattgtcagg |
39620324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 36 - 81
Target Start/End: Complemental strand, 54368764 - 54368719
Alignment:
| Q |
36 |
gcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
54368764 |
gcttgtgaggtgaggattgccaccacttataaatacattgtcaggc |
54368719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 21 - 73
Target Start/End: Original strand, 2806313 - 2806365
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
2806313 |
aaccccacaaaactggcttgtgaggtgaggattccacccacttataaacacat |
2806365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 107
Target Start/End: Original strand, 13574709 - 13574797
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||| ||||||||||| ||| ||| || || | |||||||||||| |||||| |
|
|
| T |
13574709 |
acaaccccacaaaaccggcttgtgaggtgacgatcgcccgcacttataaacgcatgctcaagccatattttgtccgatgtgggactctt |
13574797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 17638456 - 17638405
Alignment:
| Q |
29 |
aaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
17638456 |
aaaaccggcttgtgagatgaggattgcc-ccacttataaacaaattgtcaggc |
17638405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 23610396 - 23610448
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| || |||||||||||||| |
|
|
| T |
23610396 |
acaaccccacaaaaccggcctgtgagttgaggattacccccacttataaacac |
23610448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 15019303 - 15019357
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||||| ||||||||||| ||||||| ||||| |||||||||||||||||| |
|
|
| T |
15019303 |
acaaccccataaaaccggcttatgaggtggtgattgtctccacttataaacacat |
15019357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 63
Target Start/End: Original strand, 24502103 - 24502141
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccactt |
63 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24502103 |
ccacaaaaccggtttgtgaggtgaggattgcctccactt |
24502141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 23 - 77
Target Start/End: Original strand, 29215843 - 29215897
Alignment:
| Q |
23 |
ccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtc |
77 |
Q |
| |
|
||||||||||| ||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
29215843 |
ccccacaaaactggcatgtgaggtgaggattatcaccacttataaacacattgtc |
29215897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 52994831 - 52994777
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||| |||||||||| || ||||||| ||| |||||||||||||||||||| |
|
|
| T |
52994831 |
ccacaaaatcggcttgtgatgtaaggattgtctcaacttataaacacattgtcag |
52994777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 70
Target Start/End: Complemental strand, 20479060 - 20479016
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
||||||| |||||||||||||||||||| || ||||||||||||| |
|
|
| T |
20479060 |
cacaaaaacggcttgtgaggtgaggatttcccccacttataaaca |
20479016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 27 - 67
Target Start/End: Original strand, 21809180 - 21809220
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataa |
67 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
21809180 |
acaaaaccggcttgtgaggtgtggattgcccccacttataa |
21809220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 73
Target Start/End: Complemental strand, 41915220 - 41915176
Alignment:
| Q |
29 |
aaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||| || ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41915220 |
aaaactggtttgtgaggtgaggattgcccccacttataaacacat |
41915176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 80
Target Start/End: Original strand, 3975389 - 3975444
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||||| ||||||| ||||||| |||| | ||||||||||||||||||||||| |
|
|
| T |
3975389 |
ccacaaaatcggcttgagaggtgatgattatccccacttataaacacattgtcagg |
3975444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 27 - 58
Target Start/End: Original strand, 21832217 - 21832248
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21832217 |
acaaaaccggcttgtgaggtgaggattgcctc |
21832248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 1681764 - 1681710
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||| ||||||||||||||||| ||||| |||| | |||||||||||||||| |
|
|
| T |
1681764 |
acaacctcacaaaaccggcttgtggggtgatgattacacccacttataaacacat |
1681710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 33205524 - 33205470
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||| || ||||||||||| |
|
|
| T |
33205524 |
acaaccccgcaaaactggcttgtgaggtgaggattgcccttacatataaacacat |
33205470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 59
Target Start/End: Complemental strand, 34992953 - 34992923
Alignment:
| Q |
29 |
aaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34992953 |
aaaaccggcttgtgaggtgaggattgcctcc |
34992923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 56
Target Start/End: Complemental strand, 14611235 - 14611198
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcc |
56 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
14611235 |
acaactccactaaaccggcttgtgaggtgaggattgcc |
14611198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 28087240 - 28087306
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgagg----attgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||| ||||||||||||||||||||||||| | |||||| ||||||||||||| ||||| |||| |
|
|
| T |
28087240 |
acaatcccacaaaaccggcttgtgaggtgatgattaattgcccccacttataaacaaattgttaggc |
28087306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 38 - 79
Target Start/End: Complemental strand, 33640321 - 33640280
Alignment:
| Q |
38 |
ttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
33640321 |
ttgtgaggtgaagattgtccccacttataaacacattgtcag |
33640280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 59
Target Start/End: Complemental strand, 34992664 - 34992631
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
34992664 |
cacaaaaccggcttgtgagatgaggattgcctcc |
34992631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 20 - 69
Target Start/End: Complemental strand, 50070262 - 50070213
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaac |
69 |
Q |
| |
|
|||||| |||||||| |||||| ||||||| |||||| |||||||||||| |
|
|
| T |
50070262 |
caaccctacaaaaccagcttgtaaggtgagaattgcccccacttataaac |
50070213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 37 - 113
Target Start/End: Complemental strand, 2123848 - 2123772
Alignment:
| Q |
37 |
cttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||| |||| ||||| | ||||| ||| |||||||||||| |
|
|
| T |
2123848 |
cttgcgaggtgaggattgccctcacttataaacacattatcagatcatgtcctatccgacgtgagactcttaacaat |
2123772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 98
Target Start/End: Complemental strand, 2805422 - 2805342
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctcc-acttataaacacattgtcaggcaatgtcatgtccgatgt |
98 |
Q |
| |
|
|||| ||||||||||| ||| ||||||||| |||||| || ||||||||||||||||| || | || |||| |||||||| |
|
|
| T |
2805422 |
acaatcccacaaaaccaacttatgaggtgagaattgccccccacttataaacacattgttagaccatctcatatccgatgt |
2805342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 9264104 - 9264136
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
9264104 |
acaaaaccggcttgtaaggtgaggattgcctcc |
9264136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 9264311 - 9264343
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
9264311 |
acaaaaccggcttgtaaggtgaggattgcctcc |
9264343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 13740888 - 13740948
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||| |||||| |||||||||||||| |||| || |||||| |||||| |||||||| |
|
|
| T |
13740888 |
acaacccaacaaaaatggcttgtgaggtgatgatttcccccacttgtaaacatattgtcag |
13740948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 37223831 - 37223799
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
37223831 |
acaaaaccggcttgtaaggtgaggattgcctcc |
37223799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 39078789 - 39078821
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
39078789 |
acaaaaccggcttgtaaggtgaggattgcctcc |
39078821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 39956692 - 39956724
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
39956692 |
acaaaaccggcttgtaaggtgaggattgcctcc |
39956724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 40230657 - 40230689
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
40230657 |
acaaaaccggcttgtaaggtgaggattgcctcc |
40230689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 47702434 - 47702474
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
|||||||||||||||| |||||| || |||||||||||||| |
|
|
| T |
47702434 |
acaaccccacaaaaccagcttgtaagatgaggattgcctcc |
47702474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 49477413 - 49477381
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
49477413 |
acaaaaccggcttgtaaggtgaggattgcctcc |
49477381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 49477620 - 49477588
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
49477620 |
acaaaaccggcttgtaaggtgaggattgcctcc |
49477588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 50692409 - 50692377
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
50692409 |
acaaaaccggcttgtaaggtgaggattgcctcc |
50692377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 50692612 - 50692580
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
50692612 |
acaaaaccggcttgtaaggtgaggattgcctcc |
50692580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 51338459 - 51338491
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
51338459 |
acaaaaccggcttgtaaggtgaggattgcctcc |
51338491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 51642446 - 51642478
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
51642446 |
acaaaaccggcttgtaaggtgaggattgcctcc |
51642478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 51642653 - 51642685
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
51642653 |
acaaaaccggcttgtaaggtgaggattgcctcc |
51642685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 53639983 - 53640015
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
53639983 |
acaaaaccggcttgtaaggtgaggattgcctcc |
53640015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 97)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 18 - 111
Target Start/End: Complemental strand, 2030064 - 2029971
Alignment:
| Q |
18 |
aacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
2030064 |
aacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggtcatgtcatgtccgatgtgggactcttaaca |
2029971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 18 - 112
Target Start/End: Complemental strand, 2029829 - 2029735
Alignment:
| Q |
18 |
aacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||| ||||||||||| |
|
|
| T |
2029829 |
aacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaacaa |
2029735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 17525363 - 17525455
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||| |||||||||| |
|
|
| T |
17525363 |
acaatcccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcatgtccgatgtgggactcttaaca |
17525455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 14466435 - 14466527
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
14466435 |
acaaccccacaaaaccggcttgtaaggtgaggattgctcccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
14466527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 16419561 - 16419469
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||| | |||||||||| |||||||||| |
|
|
| T |
16419561 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctatccgatgtgggactcttaaca |
16419469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 5711464 - 5711556
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| || || | |||||||||| |||||||||| |
|
|
| T |
5711464 |
acaaccccacaaaaccggcttgttaggtgaggattgcccccacttataaacacattgtcaggccatttcctttccgatgtgggactcttaaca |
5711556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 5711700 - 5711792
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||| | |||||| ||||||| |||||||||||||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
5711700 |
acaaccccacaaaaccggcttttaaggtgatgattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
5711792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 37840396 - 37840302
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || || | ||| |||||| |||||||||||| |
|
|
| T |
37840396 |
acaaccccacaaaaccggcttgtgaggtgatgattgcctccacttataaacacattgtcaggtcatctcctatccaatgtgggactcttaacaat |
37840302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 19 - 112
Target Start/End: Complemental strand, 17719459 - 17719366
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| || | | |||||||||| ||||||||||| |
|
|
| T |
17719459 |
acaacccgacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaacaa |
17719366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 40379234 - 40379326
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| || | | |||||||||| |||||||||| |
|
|
| T |
40379234 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacactgtcaggccatcacctatccgatgtgggactcttaaca |
40379326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 40379469 - 40379561
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| || | | |||||||||| |||||||||| |
|
|
| T |
40379469 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacactgtcaggccatcacctatccgatgtgggactcttaaca |
40379561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 32884166 - 32884074
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
32884166 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
32884074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 2324533 - 2324471
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
2324533 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggc |
2324471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 2324299 - 2324239
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
2324299 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcag |
2324239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 37812301 - 37812385
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| || |||||||||||||||||| | |||||||||||||||||||||||| ||||| | |||||||||| |||||||||| |
|
|
| T |
37812301 |
acaaaatcgacttgtgaggtgaggattgtccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
37812385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 37812531 - 37812615
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| || |||||||||||||||||||| ||||||||||||||||||||||| ||||| | |||||||||| |||||||||| |
|
|
| T |
37812531 |
acaaaatcgacttgtgaggtgaggattgcccccacttataaacacattgtcaggtcatgtcttatccgatgtgggactcttaaca |
37812615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 25 - 111
Target Start/End: Original strand, 5851713 - 5851802
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt---caggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||| ||||||| ||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
5851713 |
ccacaaaaccggcttgtgaggtgaggattgtccccacttataaatacattgtcagcaggccatgtcctgtccgatgtgggactcttaaca |
5851802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 26 - 112
Target Start/End: Original strand, 94052 - 94138
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||| |||||||| || | | |||||||||| ||||||||||| |
|
|
| T |
94052 |
cacaaaaccgacttgtgaggtgaggattgcccccacttataaacacactgtcaggccatcacctatccgatgtgggactcttaacaa |
94138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 16533606 - 16533544
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16533606 |
acaacctcacaaaaccggcttgtgaagtgaggattgcccccacttataaacacattgtcaggc |
16533544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 25 - 111
Target Start/End: Original strand, 33606085 - 33606171
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| | ||||||||||||||| |||||| || || | |||||||||| |||||||||| |
|
|
| T |
33606085 |
ccacaaaaccggtttgtgaggtgaggattgcccctacttataaacacattttcaggccatctcctatccgatgtgggactcttaaca |
33606171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 17854954 - 17855015
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
17854954 |
acaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcagg |
17855015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 15124573 - 15124665
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| |||||| ||||||| |||||||| ||||||||||||| |||||||| | |||| | |||||||||| |||||||||| |
|
|
| T |
15124573 |
acaaccccacaaaatcggcttatgaggtggggattgcccccacttataaacatattgtcagaccatgttctatccgatgtgggactcttaaca |
15124665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 28407818 - 28407910
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||| ||||| |||| | || | ||||||||| |||||||||| |
|
|
| T |
28407818 |
acaactccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgttaggccaattcctaaccgatgtgggactcttaaca |
28407910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 29718387 - 29718295
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| || | || | ||||||||| |||||||||| |
|
|
| T |
29718387 |
acaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcaagccaactcctaaccgatgtgggactcttaaca |
29718295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 32356444 - 32356353
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||||| ||||||||||||||||||||| | || |||||||||||||| |||||||||| |
|
|
| T |
32356444 |
acaactccacaaaactggcttgtg-ggtgaggattgcccccacttataaacacattgtcatgtcatctcatgtccgatgtgagactcttaaca |
32356353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 42639639 - 42639731
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| | ||| |||||||||||||||||| | ||||||| | | |||||| |||||||||| |
|
|
| T |
42639639 |
acaaccccacaaaaccagcttgtgaggtgacgattgtccccatttataaacacattgtcagaccatgtcatattcaatgtgggactcttaaca |
42639731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 19191635 - 19191697
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||| | |||||||| |
|
|
| T |
19191635 |
acaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaacaaactgtcaggc |
19191697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 39 - 112
Target Start/End: Complemental strand, 4662270 - 4662197
Alignment:
| Q |
39 |
tgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||| ||||| | |||||||||| ||||||||||| |
|
|
| T |
4662270 |
tgtgaggtgaggattgcccccacttataaacatattgtcaggtcatgtcctatccgatgtgggactcttaacaa |
4662197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 112
Target Start/End: Complemental strand, 15464828 - 15464735
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| ||||||| | |||||||||||| | || |||| | |||||| |||||||||||| |
|
|
| T |
15464828 |
acaaccccacaaaactggtttgtgaggtgaggattgcccccacttaaatacacattgtcagaccatctcatatttgatgtgaaactcttaacaa |
15464735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 36352184 - 36352241
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
36352184 |
acaaccccacaaaaccggcttttgaggtgatgattgcccccacttataaacacattgt |
36352241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 93156 - 93239
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||| ||||||||| |||| |||||||||||||||||||||||| || | | |||||||||| |||||||||| |
|
|
| T |
93156 |
acaaaaccggcttgtaaggtgaggagtgcccccacttataaacacattgtcaggc-atcacctatccgatgtgggactcttaaca |
93239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 5509138 - 5509078
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| || ||||||||||||| |||||||| |
|
|
| T |
5509138 |
acaaccccacaaaaccagcttgtgaggtgaggattacccccacttataaacaaattgtcag |
5509078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 11020617 - 11020557
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11020617 |
acaatcccactaaatcggcttgtgaggtgaggattgcctccacttataaacacattttcag |
11020557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 25082562 - 25082622
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
25082562 |
acaaccccacaaaactggcttgtgaggtgatgattgcccctacttataaacacattgtcag |
25082622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 27897631 - 27897722
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
27897631 |
acaaccccacaaaaccgacttgtgaggtgagaattgcc-ccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
27897722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 5509369 - 5509314
Alignment:
| Q |
22 |
accccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtc |
77 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||| |
|
|
| T |
5509369 |
accccacaaaaccggcttgtggggtgaggattgcccccacttataaacaaattgtc |
5509314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 37769968 - 37770027
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||| ||||||||||||| ||||||| |
|
|
| T |
37769968 |
acaaccccacaaaaccggcttatgaggtgaagattgcccccacttataaacaaattgtca |
37770027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 14927352 - 14927290
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||| |||||||| |||||| |||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
14927352 |
acaactccacaaaatcggcttatgaggtgaggattgcccccacttataaacatattgtcaggc |
14927290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 112
Target Start/End: Original strand, 40149260 - 40149344
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||||||||| ||||||||||||| |||||| ||||||||||||||||||| ||| || |||| |||||||||| ||||||||||| |
|
|
| T |
40149260 |
cacaaaaccgacttgtgaggtgagaattgcc-ccacttataaacacattgttaggtcatctcatatccgatgtgg-actcttaacaa |
40149344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 12343775 - 12343868
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||||||||||| | ||| ||| |||||||||||| |||||||||| ||||||||| | | || || | |||||||||| ||||||||||| |
|
|
| T |
12343775 |
acaaccccacaaaactgacttatgatgtgaggattgcccccacttataagcacattgtctgaccatctcctatccgatgtgggactcttaacaa |
12343868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 58 - 111
Target Start/End: Original strand, 14466239 - 14466292
Alignment:
| Q |
58 |
ccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
14466239 |
ccacttataaacacattgttaggccatgtcctgtccgatgtggaactcttaaca |
14466292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 72
Target Start/End: Original strand, 40149028 - 40149081
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacaca |
72 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
40149028 |
acaaccccacaaaatcggcttgtgaggtgaggattgtccccacttataaacaca |
40149081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 9927970 - 9927910
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||| |||| | |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
9927970 |
acaaccccaaaaaatcagcttgtgaggtgaggattacccccacttataaacacattgtcag |
9927910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 17854717 - 17854809
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| |||||||||||| |||||||| ||| ||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
17854717 |
acaatcccacaaaaccgacttgtgagatgatgattgcccccacttataaacagattgtcaggctaactcctaaccgatgtgggactcttaaca |
17854809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 24396159 - 24396067
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||| |||||| ||||| ||| || | ||||||||||| |||||||||| || | || |||||||||| |||||||||| |
|
|
| T |
24396159 |
acaaccccacaaaaccgacttgtggggtgataattacccctacttataaacatattgtcaggccatcttatatccgatgtgggactcttaaca |
24396067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 81
Target Start/End: Original strand, 36316078 - 36316138
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||| ||||||| | |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
36316078 |
aaccccacaaaactggcttgtaatgtgaggattgcccccacttataaacaaattgtcaggc |
36316138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 25 - 80
Target Start/End: Original strand, 19544402 - 19544456
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
19544402 |
ccacaaaaccggcttgtgaggtga-gattgcccccacttataaacacattatcagg |
19544456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 25 - 99
Target Start/End: Original strand, 17525130 - 17525204
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtg |
99 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||| ||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
17525130 |
ccacaaaaccggcttgtgcggtgaggattcttcccatttataaacacattgtcaggtcatgtcctgtccgatgtg |
17525204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 69
Target Start/End: Complemental strand, 17719625 - 17719575
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaac |
69 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||| |||||||||||| |
|
|
| T |
17719625 |
acaaccccacaaaaccggtttgtgaggtcaggattgcccccacttataaac |
17719575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 67
Target Start/End: Original strand, 93479 - 93520
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataa |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
93479 |
cacaaaaccggcttgtgaggtgaggattgcccccacttataa |
93520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 67
Target Start/End: Original strand, 93752 - 93793
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataa |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
93752 |
cacaaaaccggcttgtgaggtgaggattgcccccacttataa |
93793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 14927161 - 14927100
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||| |||||| | | ||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14927161 |
acaaccacacaaagctgacttatgaggtgaggattgcccccacttataaacacattgtcagg |
14927100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 31700770 - 31700865
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgagg---attgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||| | |||||| ||||||||||||||||||||||| || | | ||||||||| ||||||||||| |
|
|
| T |
31700770 |
acaaacccacaaaaccggcttgtgaggtggtgggaattgccctcacttataaacacattgtcaggccatcacctatccgatgtgtaactcttaaca |
31700865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 25 - 74
Target Start/End: Original strand, 33606320 - 33606369
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacatt |
74 |
Q |
| |
|
||||||||| ||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
33606320 |
ccacaaaactggcttgtgaggtgaggattacccccacttataaacacatt |
33606369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 8424947 - 8424887
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||| || ||||||||||| ||||||| ||||||||||| | |||||||| |
|
|
| T |
8424947 |
acaaccccacaaaactggtttgtgaggtgatgattgcccccacttataaataaattgtcag |
8424887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 10571029 - 10570985
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccactt |
63 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
10571029 |
acaaccccacaaaaccggcttgtaaggtgaagattgcctccactt |
10570985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 23 - 67
Target Start/End: Complemental strand, 15988467 - 15988423
Alignment:
| Q |
23 |
ccccacaaaaccggcttgtgaggtgaggattgcctccacttataa |
67 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
15988467 |
ccccacaaaactggcttgtgaggtgaggattgcccccacttataa |
15988423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 68
Target Start/End: Original strand, 35418440 - 35418488
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaa |
68 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
35418440 |
caaccccataaaaccggcttgtgaggtgaggattgcccccacctataaa |
35418488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 26 - 73
Target Start/End: Complemental strand, 15988265 - 15988218
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||| |||| |
|
|
| T |
15988265 |
cacaaaaccggcttgtgaggtgaggatttcccccacttataaaaacat |
15988218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 15461033 - 15460979
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||||||||||| | |||||||||||| ||||| |||||| ||||||||||| |
|
|
| T |
15461033 |
acaaccccacaaaactgtcttgtgaggtgatgattggctccacctataaacacat |
15460979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 15518811 - 15518757
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||| |||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
15518811 |
acaaaaccaacttgtgaggttaggattgccctcacttataaacacattgtcaggc |
15518757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 27 - 81
Target Start/End: Original strand, 18607042 - 18607096
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||| |||||||| ||||| | ||||| |||||||||||||||||| |
|
|
| T |
18607042 |
acaaaaccggcttttgaggtgatgattgtccccactaataaacacattgtcaggc |
18607096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 24395922 - 24395861
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| ||||| ||||||||||||| |||| |
|
|
| T |
24395922 |
acaaccccacaaaatcgatttgtgaggtgaggattgcc-ccactcataaacacattgttaggc |
24395861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 27036440 - 27036529
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||| ||||||||||||| ||||| |||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
27036440 |
acaaccctacaaaaccggcttatgagg---ggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
27036529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 74
Target Start/End: Complemental strand, 3738982 - 3738937
Alignment:
| Q |
29 |
aaaaccggcttgtgaggtgaggattgcctccacttataaacacatt |
74 |
Q |
| |
|
|||||||| |||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
3738982 |
aaaaccggtttgtgatgtgaggattgcccccacttataaacacatt |
3738937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 13486393 - 13486300
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| | | ||||||||||||||||| || ||||||||||| | |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
13486393 |
acaaccccacaaaatcagtttgtgaggtgaggattgccccccacttataaataaattgtcaggccaactcctaaccgatgtgggactcttaaca |
13486300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 40718232 - 40718289
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
||||| |||||||||||| ||||||||||| ||||||| |||||||||||| ||||| |
|
|
| T |
40718232 |
acaactccacaaaaccggtttgtgaggtgatgattgccctcacttataaacaaattgt |
40718289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 51
Target Start/End: Complemental strand, 16419326 - 16419294
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgagga |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
16419326 |
acaaccccacaaaaccggcttgtgaggtgagga |
16419294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 73
Target Start/End: Original strand, 19571005 - 19571053
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||||| || ||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
19571005 |
ccacaaaatcgacttatgaggtgaggattgcccccacttataaacacat |
19571053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 67
Target Start/End: Original strand, 31008596 - 31008644
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataa |
67 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
31008596 |
acaaccccacaaaaccggcatgtgaggtgagaattgcccacacttataa |
31008644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 109
Target Start/End: Complemental strand, 32356668 - 32356585
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaa |
109 |
Q |
| |
|
|||||||||| |||||||| |||||||||| | |||| |||||| | ||| |||| || |||||||||||||||||||||||| |
|
|
| T |
32356668 |
ccacaaaaccagcttgtgacgtgaggattgtc-ccacctataaatatattatcagttcatctcatgtccgatgtggaactcttaa |
32356585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 36 - 80
Target Start/End: Original strand, 36351968 - 36352012
Alignment:
| Q |
36 |
gcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||||||||||| |||| | ||||||||||||||||||||||| |
|
|
| T |
36351968 |
gcttgtgaggtgagaattgtccccacttataaacacattgtcagg |
36352012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 107
Target Start/End: Complemental strand, 10523311 - 10523224
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
|||||||||||||| |||||||||||||||| || | ||||| |||||||||||||| | || || | |||||||||| |||||| |
|
|
| T |
10523311 |
caaccccacaaaactagcttgtgaggtgaggaatgttcctacttaaaaacacattgtcagaccatctcttatccgatgtgggactctt |
10523224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 15124808 - 15124867
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
||||||||||||||||| |||||| |||| ||||||| |||||||||||||| ||||| |
|
|
| T |
15124808 |
acaaccccacaaaaccgaattgtgaagtgaagattgccctcacttataaacacactgtca |
15124867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 32 - 79
Target Start/End: Original strand, 44404196 - 44404243
Alignment:
| Q |
32 |
accggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||||| |||||||| |
|
|
| T |
44404196 |
accggcttgtgaggtgatgattgcccccacttacaaacatattgtcag |
44404243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 71
Target Start/End: Complemental strand, 8227406 - 8227356
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||| ||||||||| || || |||||||||||||| |||||||||||||| |
|
|
| T |
8227406 |
aaccctacaaaaccgcctcgtaaggtgaggattgcccccacttataaacac |
8227356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 80
Target Start/End: Original strand, 24666264 - 24666318
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||| ||| ||||||||||||||||||| | ||| ||||||||||| ||||| |
|
|
| T |
24666264 |
cacaaaatcggtttgtgaggtgaggattgccccaactaataaacacattttcagg |
24666318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 30006604 - 30006658
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||| ||||||||||||||||| ||||| |||| | |||||||||||||||| |
|
|
| T |
30006604 |
acaacctcacaaaaccggcttgtgtggtgatgattatccccacttataaacacat |
30006658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 30063292 - 30063346
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||| ||||||||||||||||| ||||| |||| | |||||||||||||||| |
|
|
| T |
30063292 |
acaacctcacaaaaccggcttgtgtggtgatgattatccccacttataaacacat |
30063346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 81
Target Start/End: Original strand, 44403959 - 44404013
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||| | |||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
44403959 |
acaaaaccagtttgtgaggtgaggattgcactcacttacaaacacattgtcaggc |
44404013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 48
Target Start/End: Original strand, 5450515 - 5450544
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtga |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5450515 |
acaaccccacaaaaccggcttgtgaggtga |
5450544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 21591841 - 21591780
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctcc-acttataaacacattgtcag |
79 |
Q |
| |
|
||||||||| ||||||| ||| |||||||| ||||||| || ||||||||||| |||||||| |
|
|
| T |
21591841 |
acaaccccataaaaccgacttatgaggtgaagattgccccccacttataaacaaattgtcag |
21591780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 31222580 - 31222531
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaa |
68 |
Q |
| |
|
||||||| |||||| ||| || || ||||||||||||||||||||||||| |
|
|
| T |
31222580 |
acaaccctacaaaatcggtttatggggtgaggattgcctccacttataaa |
31222531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 25 - 78
Target Start/End: Complemental strand, 38629894 - 38629841
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
||||||||||| |||||||| ||||||||| | | ||||||||| ||||||||| |
|
|
| T |
38629894 |
ccacaaaaccgacttgtgagatgaggattgtcccaacttataaatacattgtca |
38629841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 883619 - 883651
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
883619 |
acaaaaccggcttgtaaggtgaggattgcctcc |
883651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 884143 - 884111
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
884143 |
acaaaaccggcttgtaaggtgaggattgcctcc |
884111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 75
Target Start/End: Complemental strand, 4431689 - 4431657
Alignment:
| Q |
43 |
aggtgaggattgcctccacttataaacacattg |
75 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
4431689 |
aggtgaggattgcccccacttataaacacattg |
4431657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 10523078 - 10523018
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||| ||||||||| |||||| ||||||| ||||| | ||| |||||||||||||||||| |
|
|
| T |
10523078 |
acaatcccacaaaaatggcttgcgaggtgaagattgtcaccatttataaacacattgtcag |
10523018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 70
Target Start/End: Complemental strand, 13210582 - 13210534
Alignment:
| Q |
22 |
accccacaaaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| | |||||||||| |
|
|
| T |
13210582 |
accccacaaaaccgacctgtgaggtgaggattgccctctcttataaaca |
13210534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 20999007 - 20999039
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
20999007 |
acaaaaccggcttgtaaggtgaggattgcctcc |
20999039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 21383309 - 21383348
Alignment:
| Q |
19 |
acaaccccacaaaa--ccggcttgtgaggtgaggattgcc |
56 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21383309 |
acaaccccacaaaaaaccggcttgtgaggtgaggattgcc |
21383348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 29684097 - 29684065
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
29684097 |
acaaaaccggcttgtaaggtgaggattgcctcc |
29684065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 33985789 - 33985821
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
33985789 |
acaaaaccggcttgtaaggtgaggattgcctcc |
33985821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 33985993 - 33986025
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
33985993 |
acaaaaccggcttgtaaggtgaggattgcctcc |
33986025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 34775443 - 34775411
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
34775443 |
acaaaaccggcttgtaaggtgaggattgcctcc |
34775411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 40010060 - 40010028
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
40010060 |
acaaaaccggcttgtaaggtgaggattgcctcc |
40010028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 42895529 - 42895489
Alignment:
| Q |
30 |
aaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
42895529 |
aaaccggcttgtgaggtgaggattgctcctacttataaaca |
42895489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 79; Significance: 4e-37; HSPs: 88)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 22 - 112
Target Start/End: Original strand, 6400874 - 6400964
Alignment:
| Q |
22 |
accccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
6400874 |
accccacaaaaccggcttgtgaggtgaggattgcctccacttataaacatattgtcaggccatgtcatgtccgatgtgggactcttaacaa |
6400964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 4868602 - 4868694
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
4868602 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
4868694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 4868838 - 4868931
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
4868838 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgccaggccatgtcctgtccgatgtgggactcttaacaa |
4868931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 19 - 112
Target Start/End: Complemental strand, 33796385 - 33796292
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
33796385 |
acaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaacaa |
33796292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 6400645 - 6400737
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
6400645 |
acaaccccacaaaaccgacttgtgatgtgaggattgcctccacttataaacacattgtcaggccatgtcatgtccgatgtgagactcttaaca |
6400737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 13353260 - 13353168
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
13353260 |
acaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
13353168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 9705313 - 9705221
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | || ||||| | |||||||||| |||||||||| |
|
|
| T |
9705313 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgttaagccatgtcctatccgatgtgggactcttaaca |
9705221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 21 - 111
Target Start/End: Original strand, 17147687 - 17147777
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||| | |||||||||| |||||||||| |
|
|
| T |
17147687 |
aaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggtcatgtcctatccgatgtgggactcttaaca |
17147777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 6542968 - 6543060
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||| | || || | ||||||||||||||||||||| |
|
|
| T |
6542968 |
acaaccccacaaaaccggcttctgaggtgatgattgcccccacttataaacacattgtcagaccatctcttatccgatgtggaactcttaaca |
6543060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 9705079 - 9704987
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||||||||| ||||| | ||||||||| |||||||||| |
|
|
| T |
9705079 |
acaaccccacaaaaccgacttgtgaggtgatgattgcccccacttataaacacattgtcaggctatgtcctatccgatgtgagactcttaaca |
9704987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 25065119 - 25065209
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||| |||||||| | ||||| | |||||||||| |||||||| |
|
|
| T |
25065119 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccctacttataaacatattgtcagaccatgtcctatccgatgtgggactcttaa |
25065209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 112
Target Start/End: Complemental strand, 33494598 - 33494505
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||| || || || | |||||||||| ||||||||||| |
|
|
| T |
33494598 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacatattttcaagccatctcctatccgatgtgggactcttaacaa |
33494505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 8026448 - 8026356
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | |||| |||| |||| |||||||||| |
|
|
| T |
8026448 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcataaccgacgtgggactcttaaca |
8026356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 12330316 - 12330407
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||||||| | ||||| | |||||||||| |||||||||| |
|
|
| T |
12330316 |
acaacctcacaaaaccggcttgtgagatgaggattgcc-ccacttataaacacattgtcagaccatgtcctatccgatgtgggactcttaaca |
12330407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 19713011 - 19712919
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||| ||||||||||||| |||||||||| | || | |||||||||||||||||||| |
|
|
| T |
19713011 |
acaatcccacaaaaccggcttgtgaggtgagaattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtggaactcttaaca |
19712919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 21690781 - 21690689
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
21690781 |
acaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaaatcctaaccgatgtgggactcttaaca |
21690689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 27656517 - 27656425
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
27656517 |
acaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
27656425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 109
Target Start/End: Complemental strand, 13740975 - 13740885
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaa |
109 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| ||||||||||||| |||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
13740975 |
acaaccccacaaaaccgacttgtgaagtgaggattgctcccacttataaacaaattgtcaggccaacacatatccgatgtggaactcttaa |
13740885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 109
Target Start/End: Complemental strand, 13746475 - 13746385
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaa |
109 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| ||||||||||||| |||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
13746475 |
acaaccccacaaaaccgacttgtgaagtgaggattgctcccacttataaacaaattgtcaggccaacacatatccgatgtggaactcttaa |
13746385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 27772773 - 27772711
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
27772773 |
acaactccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggc |
27772711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 28867982 - 28868076
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| | ||||||||| | || | ||||||||| |||||||||||| |
|
|
| T |
28867982 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaataaattgtcaggtcaactcgtaaccgatgtgggactcttaacaat |
28868076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 109
Target Start/End: Complemental strand, 30256871 - 30256782
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| || | | |||||||||| |||||||| |
|
|
| T |
30256871 |
acaaccccacaaaaccggcttgtgaggtgaggattgcc-ccacttataaacatattgtcaggtcatcacctatccgatgtgggactcttaa |
30256782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 96
Target Start/End: Original strand, 12330204 - 12330281
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgat |
96 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||| |||||||||||||||||||||| | ||||| | |||||| |
|
|
| T |
12330204 |
acaacctcacaaaaccggcttgtgaggtgagggttgcccccacttataaacacattgtcagaccatgtcctatccgat |
12330281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 112
Target Start/End: Complemental strand, 24554176 - 24554083
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||| ||||||||||| | |||||||| | || || | |||||||||| ||||||||||| |
|
|
| T |
24554176 |
acaactccacaaaaccggcttgtgaggtgaagattgcccccacttataaatatattgtcagaccatctcctatccgatgtgggactcttaacaa |
24554083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 2736435 - 2736519
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||| ||||||| ||||| |||||| ||||||||||||||||| ||||| || |||| ||||||||||||||||||||| |
|
|
| T |
2736435 |
acaaaaccgacttgtgatgtgagaattgcccccacttataaacacattatcaggtcatctcatatccgatgtggaactcttaaca |
2736519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 2737203 - 2737287
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||| ||||||| ||||| |||||| ||||||||||||||||| ||||| || |||| ||||||||||||||||||||| |
|
|
| T |
2737203 |
acaaaaccgacttgtgatgtgagaattgcccccacttataaacacattatcaggtcatctcatatccgatgtggaactcttaaca |
2737287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 2753317 - 2753257
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
2753317 |
acaaccccacaaaaccgccttgtgaggtgaggattacccccacttataaacacattgtcag |
2753257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 4906865 - 4906773
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| |||| ||||| |||||||||| ||||||||||| ||||||||||||||||||| | |||| || | ||||||||||||||||||||| |
|
|
| T |
4906865 |
acaatcccataaaactggcttgtgagatgaggattgccctcacttataaacacattgtccgacaatctcttatccgatgtggaactcttaaca |
4906773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 18 - 81
Target Start/End: Complemental strand, 7915911 - 7915847
Alignment:
| Q |
18 |
aacaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
7915911 |
aacaaccccacaaaatcggcttgtgaggtgaggattgccccccacttataaacacattgtcaggc |
7915847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 27773005 - 27772913
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
27773005 |
acaatcccacaaaaccagcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
27772913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 30256637 - 30256545
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| ||| ||||||||||||||||| | |||| ||||||||||| |||||||||| |
|
|
| T |
30256637 |
acaaccccacaaaaccggtttgtgagttgaggattgcccccagttataaacacattgtcaaaccatgtattgtccgatgtgagactcttaaca |
30256545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 70
Target Start/End: Complemental strand, 19712773 - 19712722
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19712773 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca |
19712722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 8566984 - 8567077
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| | |||||||||||||||||||||| | || | | ||||| |||| |||||||||||| |
|
|
| T |
8566984 |
acaaccccacaaaaccggtttgtgaggtgaggattgtc-ccacttataaacacattgtcagaccatcacctatccgaggtgggactcttaacaat |
8567077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 26 - 111
Target Start/End: Complemental strand, 3680298 - 3680213
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||| |||||||||||| ||||||| |||||||||||||||||||||| | || ||| |||||||||| |||||||||| |
|
|
| T |
3680298 |
cacaaaaccaacttgtgaggtgatgattgcccccacttataaacacattgtcagaccatcacatatccgatgtgggactcttaaca |
3680213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 11721964 - 11721907
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
11721964 |
acaaccccacaaaaccggcttatgaggtgaggattgcccccacttataaacaaattgt |
11721907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 83
Target Start/End: Original strand, 5572409 - 5572473
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaa |
83 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||| | ||||||||||| |||||||||||| |
|
|
| T |
5572409 |
acaaccccacaaaaccgacttgtgaggtgaggatggccccaacttataaacaaattgtcaggcaa |
5572473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 23 - 111
Target Start/End: Original strand, 19639142 - 19639230
Alignment:
| Q |
23 |
ccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| | |||||||||||||||||||||||| || || | ||| |||||| | |||||||| |
|
|
| T |
19639142 |
ccccactaaaccggtttgtgaggtgaggattgtccccacttataaacacattgtcaggccatatcttatcctatgtgggattcttaaca |
19639230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 27653276 - 27653184
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||| || ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
27653276 |
acaatcccacaaaaccgacttgtgaggtgaggatttcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
27653184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 16722832 - 16722918
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactc |
105 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||| ||||||||||||| ||| |||||| || ||| |||||||||| |||| |
|
|
| T |
16722832 |
acaaccccacaaaatcggcttgtgaggtgagaattgctcccacttataaacagattatcaggccatcacatatccgatgtgggactc |
16722918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 12329969 - 12330026
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
|||||| ||||||| | ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12329969 |
acaacctcacaaaatcagcttgtgaggtgaggattgcccccacttataaacacattgt |
12330026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 38 - 111
Target Start/End: Complemental strand, 31961218 - 31961145
Alignment:
| Q |
38 |
ttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||| || ||| || ||||||| |||||||||| |
|
|
| T |
31961218 |
ttgtgaggtaaggattgcccccacttataaacacattgtcaggccatcacatatctgatgtgggactcttaaca |
31961145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 6054462 - 6054370
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||| |||||| ||| ||||||||||||||||||| ||||||||||| || ||||||| | || || | |||||||| | |||||||||| |
|
|
| T |
6054462 |
acaaccctacaaaatcggtttgtgaggtgaggattgcccccacttataaataccttgtcagaccatctcttatccgatgttggactcttaaca |
6054370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 13740740 - 13740680
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||| |||||||||| ||| ||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
13740740 |
acaacctcacaaaaccgacttatgaggcgaggattgtctccacttataaacacattgtcag |
13740680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 13746240 - 13746180
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||| |||||||||| ||| ||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
13746240 |
acaacctcacaaaaccgacttatgaggcgaggattgtctccacttataaacacattgtcag |
13746180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 11085640 - 11085582
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtc |
77 |
Q |
| |
|
|||||| |||||||||||||||||| ||||| |||||| ||||||||||||| |||||| |
|
|
| T |
11085640 |
acaaccgcacaaaaccggcttgtgaagtgagaattgcccccacttataaacatattgtc |
11085582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 108
Target Start/End: Original strand, 12199837 - 12199919
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctta |
108 |
Q |
| |
|
|||||||| | |||||||||||| ||||||| ||||||||||||| |||||||| | || || | |||||||||| ||||||| |
|
|
| T |
12199837 |
cacaaaacggacttgtgaggtgatgattgcccccacttataaacatattgtcagaccatatcttatccgatgtgggactctta |
12199919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 61 - 111
Target Start/End: Complemental strand, 13353453 - 13353403
Alignment:
| Q |
61 |
cttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
13353453 |
cttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
13353403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 15082169 - 15082226
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtc |
77 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
15082169 |
acaatcccacaaaaccggcttgtgaggtgaggactg-ttccacttataaacacattgtc |
15082226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 61 - 111
Target Start/End: Complemental strand, 33796578 - 33796528
Alignment:
| Q |
61 |
cttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
33796578 |
cttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
33796528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 80
Target Start/End: Complemental strand, 3713393 - 3713340
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||| |||||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3713393 |
acaaaatcggcttttgatgtgaggattgcctcaacttataaacacattgtcagg |
3713340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 78
Target Start/End: Original strand, 5572643 - 5572699
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
5572643 |
aaccccacaaa-ccggcttgtgaggtgaggatggcccccacttataaacaaattgtca |
5572699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 32 - 81
Target Start/End: Original strand, 6237740 - 6237789
Alignment:
| Q |
32 |
accggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
6237740 |
accggcttgtgaggtgaggattgccctcacttataaatacattgtcaggc |
6237789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 56
Target Start/End: Complemental strand, 8026663 - 8026626
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcc |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8026663 |
acaaccccacaaaaccggcttgtgaggtgaggattgcc |
8026626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 112
Target Start/End: Complemental strand, 15600995 - 15600902
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||||||||||| | ||||||| |||||||||||| ||||||||||||| ||| |||| | | || | ||||||||| ||||||||||| |
|
|
| T |
15600995 |
acaaccccacaaaactgacttgtgaagtgaggattgcccccacttataaacaaattatcagaccaactcctaaccgatgtgggactcttaacaa |
15600902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 16570218 - 16570157
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||||||||||| ||||| | ||||||||| || || |||||||||||||||||||| |
|
|
| T |
16570218 |
acaaccccacaaaaccgacttgttacgtgaggattacccccgcttataaacacattgtcagg |
16570157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 3680071 - 3680011
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||| || |||||||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
3680071 |
acaaccccacaaaatcgacttgtgagaggaggattgcccccagttataaacacattgtcag |
3680011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 6542734 - 6542825
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||| |||||||||| ||||||||||| ||||||| ||| ||||||||| |||||||| | || || | ||||||||| |||||||||| |
|
|
| T |
6542734 |
acaaccctacaaaaccggtttgtgaggtgatgattgcc-ccatttataaacagattgtcagaccatctcctatccgatgtgagactcttaaca |
6542825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 63
Target Start/End: Original strand, 6623435 - 6623479
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccactt |
63 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
6623435 |
acaaccccacaaaaccggcttgtaaggtgaggattgcccccactt |
6623479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 7333107 - 7333159
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7333107 |
acaaccctacaaaactggcttgtgaggtgaggaccgcctccacttataaacac |
7333159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 15081933 - 15081993
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||| ||||||||||||||||||||| | ||||||||| |||||| |||||| |||||||| |
|
|
| T |
15081933 |
acaatcccacaaaaccggcttgtgagttaaggattgcccccacttgtaaacatattgtcag |
15081993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 75
Target Start/End: Original strand, 30849427 - 30849483
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattg |
75 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||| |||||||||| ||||||| |
|
|
| T |
30849427 |
acaaccccacaaaaccggcttgcgatgtgaggattgctcccacttataagcacattg |
30849483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 33631831 - 33631890
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33631831 |
caaccccacaaaaccgg-ttatgaggtgaggattgttcccacttataaacacattgtcagg |
33631890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 26 - 73
Target Start/End: Original strand, 10145547 - 10145594
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||| |||||||||||| |
|
|
| T |
10145547 |
cacaaaaccggcttgtgaggttaggattgcttccatttataaacacat |
10145594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 6066034 - 6065976
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| || ||||||||||||||||||| |
|
|
| T |
6066034 |
acaaccccacaaaaccaacttgtcaggtgaggattgc--ccccttataaacacattgtcag |
6065976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 15102964 - 15103017
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||||| ||||| ||||| |||||| || |||||||||||||||||||| |
|
|
| T |
15102964 |
acaaaaccggcctgtgaagtgagaattgcccccgcttataaacacattgtcagg |
15103017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 21215044 - 21214987
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
||||||||||||||||| ||| |||||||| ||||||| ||||||||||||||||| |
|
|
| T |
21215044 |
acaaccccacaaaaccgacttttgaggtgatgattgcccaaacttataaacacattgt |
21214987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 111
Target Start/End: Complemental strand, 30505789 - 30505704
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccactt-ataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| |||||| |||||||||||||| | |||||| | |||||||||||||| | || | || |||||||||| |||||||||| |
|
|
| T |
30505789 |
acaaaatcggcttatgaggtgaggattgtccccactttacaaacacattgtcagaccatcttatatccgatgtgggactcttaaca |
30505704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 33494834 - 33494741
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgagg-attgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||| || | ||||||||||| | |||||||| | || || | |||||||||| |||||||||| |
|
|
| T |
33494834 |
acaaccccataaaaccggcttgtgaggtgaggaataatccccacttataaatatattgtcagaccatctcctatccgatgtgggactcttaaca |
33494741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 80
Target Start/End: Complemental strand, 467661 - 467609
Alignment:
| Q |
28 |
caaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||||||||| ||||||||||| | || |||||| |||||||||||||||| |
|
|
| T |
467661 |
caaaaccggcttatgaggtgaggacttcccccacttgtaaacacattgtcagg |
467609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 73
Target Start/End: Original strand, 33631638 - 33631690
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||||||||||||| || | ||||||||||||| |||||||||||||||| |
|
|
| T |
33631638 |
aaccccacaaaaccggtttatatggtgaggattgcccccacttataaacacat |
33631690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 82
Target Start/End: Original strand, 1788778 - 1788825
Alignment:
| Q |
35 |
ggcttgtgaggtgaggattgcctccacttataaacacattgtcaggca |
82 |
Q |
| |
|
||||||||||||||| |||| | ||||||||||| ||||||||||||| |
|
|
| T |
1788778 |
ggcttgtgaggtgagtattgtccccacttataaatacattgtcaggca |
1788825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 41 - 80
Target Start/End: Original strand, 2736214 - 2736253
Alignment:
| Q |
41 |
tgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
2736214 |
tgaggtgaggattgtccccacttataaacacattgtcagg |
2736253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 27 - 70
Target Start/End: Original strand, 10314045 - 10314088
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||| ||||| |
|
|
| T |
10314045 |
acaaaaccggtttgtgaggtgacgattgcctccacttaaaaaca |
10314088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 37 - 80
Target Start/End: Original strand, 12199728 - 12199771
Alignment:
| Q |
37 |
cttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
12199728 |
cttgtgaggtgaggattacccccacttataaatacattgtcagg |
12199771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 79
Target Start/End: Original strand, 1788714 - 1788760
Alignment:
| Q |
33 |
ccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||| ||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
1788714 |
ccggcttgtgtggtgaagattgcccccacttataaacactttgtcag |
1788760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 80
Target Start/End: Original strand, 7638634 - 7638676
Alignment:
| Q |
38 |
ttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
7638634 |
ttgtaaggtgaggattgcccccacttataaacacattatcagg |
7638676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 73
Target Start/End: Original strand, 30711249 - 30711295
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||| ||| ||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
30711249 |
acaaaatcggtttgtgaggtgaggattgtctctacttataaacacat |
30711295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 76
Target Start/End: Complemental strand, 6369499 - 6369466
Alignment:
| Q |
43 |
aggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
6369499 |
aggtgaggattgcccccacttataaacacattgt |
6369466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 59
Target Start/End: Complemental strand, 24558670 - 24558637
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
24558670 |
cacaaaaccggcttgtaaggtgaggattgcctcc |
24558637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 3713292 - 3713252
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
|||| ||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
3713292 |
acaatcccacaaaaccggtttgtaaggtgaggattgcctcc |
3713252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 75
Target Start/End: Original strand, 5648697 - 5648753
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattg |
75 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||| | | |||||||||||||| |
|
|
| T |
5648697 |
acaacctcacaaaaccggcttgtgaggtgatgattgtccttaattataaacacattg |
5648753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 15101129 - 15101161
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
15101129 |
acaaaaccggcttgtaaggtgaggattgcctcc |
15101161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 16876848 - 16876880
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
16876848 |
acaaaaccggcttgtaaggtgaggattgcctcc |
16876880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 16877028 - 16877060
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
16877028 |
acaaaaccggcttgtaaggtgaggattgcctcc |
16877060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 17147923 - 17147955
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
17147923 |
acaaaaccggcttgtaaggtgaggattgcctcc |
17147955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 55
Target Start/End: Complemental strand, 25184300 - 25184268
Alignment:
| Q |
23 |
ccccacaaaaccggcttgtgaggtgaggattgc |
55 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
25184300 |
ccccacaaaaccggcttgtaaggtgaggattgc |
25184268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 28149879 - 28149847
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
28149879 |
acaaaaccggcttgtaaggtgaggattgcctcc |
28149847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 76
Target Start/End: Original strand, 30656666 - 30656714
Alignment:
| Q |
28 |
caaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
||||||||| |||||||||||| ||| ||| |||||||||||| ||||| |
|
|
| T |
30656666 |
caaaaccggattgtgaggtgagaattaccttcacttataaacatattgt |
30656714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 77; Significance: 7e-36; HSPs: 115)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 35682806 - 35682898
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
35682806 |
acaaccccacaaaaccggcttgcgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtggaactcttaaca |
35682898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 11232219 - 11232311
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
11232219 |
acaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
11232311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 11232454 - 11232546
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| | ||||| |||||||||||| |||||||||| |
|
|
| T |
11232454 |
acaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcagaccatgtcctgtccgatgtgggactcttaaca |
11232546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 39052954 - 39053048
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || | | |||||||||| |||||||||||| |
|
|
| T |
39052954 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaacaat |
39053048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 24532446 - 24532539
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| || || | |||||||||| ||||||||||| |
|
|
| T |
24532446 |
acaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcaggccatctcctatccgatgtgggactcttaacaa |
24532539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 21 - 111
Target Start/End: Original strand, 5931976 - 5932066
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| | || ||||||| |||||||||| |
|
|
| T |
5931976 |
aaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtactatctgatgtgggactcttaaca |
5932066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 10450059 - 10449965
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||||| ||||| | ||||||||| |||||||||||| |
|
|
| T |
10450059 |
acaaccctacaaaaccggcttctgaggtgaggattgcccacacttataaacacattgtcaggccatgtcctatccgatgtgagactcttaacaat |
10449965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 12317105 - 12317011
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||| ||||||||| | |||| |||||||||||||||| |||||||||||||||||||||| | ||||| |||||||||||| |||||||||||| |
|
|
| T |
12317105 |
acaatcccacaaaatcagcttatgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctgtccgatgtgggactcttaacaat |
12317011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 38447452 - 38447514
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38447452 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggc |
38447514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 15042695 - 15042787
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| ||| ||| ||||||| ||||||| |||||||||||||||||||||||| ||||| | |||||||||| |||||||||| |
|
|
| T |
15042695 |
acaaccccacaaaatcggtttgcgaggtgatgattgcccccacttataaacacattgtcaggccatgtcgtatccgatgtgggactcttaaca |
15042787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 17469877 - 17469785
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
17469877 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
17469785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 17477124 - 17477032
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
17477124 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
17477032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 19256611 - 19256703
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
19256611 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
19256703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 28069382 - 28069474
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||| |||||||| | | ||||||||||||||||||| ||||||||||| |||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
28069382 |
acaactccacaaaatcagtttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcatatccgatgtgggactcttaaca |
28069474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 19 - 98
Target Start/End: Complemental strand, 8929076 - 8928997
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||| || |||| |||||||| |
|
|
| T |
8929076 |
acaaccccacaaaaccggcttgtgaggtgcggattgcccccagttataaacacattgtcaggccatctcatatccgatgt |
8928997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 21 - 111
Target Start/End: Original strand, 422244 - 422334
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| | || || | |||||||||| ||| |||||| |
|
|
| T |
422244 |
aaccccacaaaactggcttgtgaggtgaggattgcctccacttttaaacacattgtcagaccatctcctatccgatgtgggacttttaaca |
422334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 24075331 - 24075425
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||| | || | ||||||||| |||||||||||| |
|
|
| T |
24075331 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaagtgtcaggccaactcctaaccgatgtgggactcttaacaat |
24075425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 18 - 111
Target Start/End: Complemental strand, 25325706 - 25325613
Alignment:
| Q |
18 |
aacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| ||||||||| ||||||||||| ||||||||| ||||||||||||||||||| |||| ||||| | |||||||||| |||||||||| |
|
|
| T |
25325706 |
aacaactccacaaaactggcttgtgaggagaggattgcacccacttataaacacattgttaggccatgtcctatccgatgtgggactcttaaca |
25325613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 39960251 - 39960158
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||||||| ||| |||||| || || | |||||||||| |||||||||| |
|
|
| T |
39960251 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaattttcaggccatctcctatccgatgtgggactcttaaca |
39960158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 27 - 107
Target Start/End: Complemental strand, 7729992 - 7729912
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| ||||||| || |||| || ||||||| |||||| |
|
|
| T |
7729992 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacacatggtcaggccatctcatatctgatgtgggactctt |
7729912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 18004121 - 18004213
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| |||||||||| ||| || ||||||||||||| ||||||||||||| |||||||||| ||||| |||| ||||||| |||||||||| |
|
|
| T |
18004121 |
acaacctcacaaaaccgacttatggggtgaggattgcccccacttataaacatattgtcaggccatgtcctgtctgatgtgggactcttaaca |
18004213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 19256845 - 19256937
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
19256845 |
acaaccccacaaaacctgcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
19256937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 20301320 - 20301228
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| |||||||| |||||||||||| ||||||||| ||||||||||||||||||||| || || |||| ||| |||||| |||||||||| |
|
|
| T |
20301320 |
acaacctcacaaaacgggcttgtgaggttaggattgcccccacttataaacacattgtcaagccatctcatatccaatgtggtactcttaaca |
20301228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 21087952 - 21087860
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| |||||||| |||||||||||| ||||||||| ||||||||||||||||||||| || || |||| ||| |||||| |||||||||| |
|
|
| T |
21087952 |
acaacctcacaaaacgggcttgtgaggttaggattgcccccacttataaacacattgtcaagccatctcatatccaatgtggtactcttaaca |
21087860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 99
Target Start/End: Complemental strand, 37001523 - 37001443
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtg |
99 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| | |||||||||||||| ||||||||| || || ||||||||||| |
|
|
| T |
37001523 |
acaaccccacaaaaccggcttgtgatgtgaggattgtccccacttataaacactttgtcaggccatttcctgtccgatgtg |
37001443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 4828352 - 4828293
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
4828352 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtca |
4828293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 42846630 - 42846693
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
42846630 |
acaaccccacaaaaccggcttgtgaggtgaggattgccctccacttataaacaaattgtcaggc |
42846693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 5590393 - 5590486
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||| |||||| ||||||||||||||| | || || | |||||||||| ||||| ||||| |
|
|
| T |
5590393 |
acaacctcacaaaaccggcttgtgaagtgaggattgcccccacttgtaaacacattgtcagaccatctcctatccgatgtgggactctgaacaa |
5590486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 5932209 - 5932290
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtgg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||| || | ||||| | |||||||||| |
|
|
| T |
5932209 |
acaaccccacaaaacaggcttgtgaggtgaggcttgcccccacttataaacacattgttagaccatgtcctatccgatgtgg |
5932290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 8084186 - 8084105
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtgg |
100 |
Q |
| |
|
||||| || ||||||| ||||||||||||||||||||| ||||||||||| |||||||||| | ||||| |||||||||||| |
|
|
| T |
8084186 |
acaactccgcaaaaccagcttgtgaggtgaggattgcccccacttataaatacattgtcagactatgtcctgtccgatgtgg |
8084105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 12688366 - 12688305
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
12688366 |
acaaccccacaaaactggcttgtgaggtaaggattgcccccacttataaacacattgtcagg |
12688305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 21 - 81
Target Start/End: Complemental strand, 20515201 - 20515141
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
20515201 |
aaccccacaaaaccggcttgtgatgtgaggattgccccgacttataaacacattgtcaggc |
20515141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 39743588 - 39743496
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| | ||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
39743588 |
acaaccccacaaaatcggcttgtgaggtgaggattgccccaacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
39743496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 39984873 - 39984813
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
39984873 |
acaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaacaaattgtcag |
39984813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 4828127 - 4828068
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||||| |
|
|
| T |
4828127 |
acaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaacaaattgtca |
4828068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 3157584 - 3157678
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| || ||||||||||| |||||| ||||| || | | |||||||||| ||||||||||| |
|
|
| T |
3157584 |
acaaccccacaaaactggcttgtgaggtgaggattgccccccacttataaatacattgccaggccatcacctatccgatgtgggactcttaacaa |
3157678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 24 - 81
Target Start/End: Complemental strand, 10884119 - 10884061
Alignment:
| Q |
24 |
cccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
10884119 |
cccacaaaaccggcttgtgaggtgaggattgccccccacttataaacacattgtcaggc |
10884061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 35385836 - 35385930
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| || ||||||||||||| ||| |||||| || | | |||||||||| ||||||||||| |
|
|
| T |
35385836 |
acaaccccacaaaaccggcttatgaggtgaggattgccccccacttataaacatattatcaggctatcttctatccgatgtgggactcttaacaa |
35385930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 34843176 - 34843119
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
34843176 |
acaaccccacaaaaccggcttgtgaggtgaggattgctcccacttataaacaaattgt |
34843119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 8084421 - 8084329
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| |||||||| || ||||||||||||| || || ||||||||||| ||||||| |||| ||||| ||| |||||||| |||||||||| |
|
|
| T |
8084421 |
acaacctcacaaaactggtttgtgaggtgaggtttacccccacttataaatacattgttaggccatgtcttgttcgatgtgggactcttaaca |
8084329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 99
Target Start/End: Original strand, 22638204 - 22638284
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtg |
99 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| | |||||||||||| ||| ||||| || || | ||||||||| |
|
|
| T |
22638204 |
acaaccccacaaaaccggcttgtgtggtgaggattgcccctacttataaacactttgacaggccatctcttatccgatgtg |
22638284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 107
Target Start/End: Complemental strand, 37001285 - 37001197
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||| ||||||||| |||| |||| || || || |||||||| |||||| |
|
|
| T |
37001285 |
acaactccacaaaaccggcttgtgaggtgaggattgcccccacctataaacactttgtgaggccatctctcgttcgatgtgggactctt |
37001197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 38475806 - 38475754
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38475806 |
acaaccctacaaaaccggcttgtgaggtgaggattgcccccacttataaacac |
38475754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 24 - 80
Target Start/End: Complemental strand, 41790713 - 41790657
Alignment:
| Q |
24 |
cccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||||||||||||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
41790713 |
cccacaaaaccggcttatgaggtgaggattgtccccacttataaacacattgtcagg |
41790657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 7267490 - 7267549
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||| ||||||||||||| ||||||| |
|
|
| T |
7267490 |
acaaccctacaaaaccggcttgtgaggtgatgattgcccccacttataaacaaattgtca |
7267549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 24 - 79
Target Start/End: Complemental strand, 7669695 - 7669640
Alignment:
| Q |
24 |
cccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7669695 |
cccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacattgtcag |
7669640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 16050088 - 16050026
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||| |||||||||||| ||| |||||| |
|
|
| T |
16050088 |
acaaccccacaaaactgacttgtgaggtgaggattgccttcacttataaacaaattatcaggc |
16050026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 20094818 - 20094876
Alignment:
| Q |
18 |
aacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||| |||||||| ||||| |
|
|
| T |
20094818 |
aacaaccccacaaaaccggcttgtaaggtgaggattgcccccacatataaacatattgt |
20094876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 26800537 - 26800599
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||||||||| ||| ||| |||||| |
|
|
| T |
26800537 |
acaaccccacaaaaccggcttgtgtggtgaggattgcccccacttatagacaaattatcaggc |
26800599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 29 - 107
Target Start/End: Original strand, 29907761 - 29907839
Alignment:
| Q |
29 |
aaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
||||||| |||||||||||||||||| | |||||||||||||||||||||| | || || | |||||||||| |||||| |
|
|
| T |
29907761 |
aaaaccgacttgtgaggtgaggattgaccccacttataaacacattgtcagactatctcttatccgatgtgggactctt |
29907839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 34842737 - 34842675
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||||| | | |||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
34842737 |
acaaccccacaaaaccgacctatgaggtgaggattgcccccacttataaacaaattgtcaggc |
34842675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 42049712 - 42049766
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
42049712 |
acaacctcacaaaaccggcttgtggggtgaggattgcccccacttataaacacat |
42049766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 8716173 - 8716116
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
8716173 |
acaaccccacaaaatcggcttatgaggtgaggattgccttcacttttaaacacattgt |
8716116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 25 - 78
Target Start/End: Complemental strand, 20301554 - 20301501
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
||||| |||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20301554 |
ccacacaaccggcttgtggggtgaggattgcccccacttataaacacattgtca |
20301501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 25 - 78
Target Start/End: Complemental strand, 21088186 - 21088133
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
||||| |||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21088186 |
ccacacaaccggcttgtggggtgaggattgcccccacttataaacacattgtca |
21088133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 22 - 79
Target Start/End: Original strand, 29099768 - 29099825
Alignment:
| Q |
22 |
accccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||| | | ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29099768 |
accccacaaaatcagtttgtgaggtgaagattgcctccacttataaacacattgtcag |
29099825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 12547157 - 12547098
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||| | |||||||| |
|
|
| T |
12547157 |
acaaccccacaaaaccggcttgtgaggtgaagattgcc-ccacttataaataaattgtcag |
12547098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 67
Target Start/End: Complemental strand, 27205023 - 27204975
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataa |
67 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
27205023 |
acaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa |
27204975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 67
Target Start/End: Complemental strand, 27205121 - 27205073
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataa |
67 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
27205121 |
acaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa |
27205073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 67
Target Start/End: Complemental strand, 27205219 - 27205171
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataa |
67 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
27205219 |
acaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa |
27205171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 31197906 - 31197814
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| ||||| |||| | |||||||||||||||||| ||||||||| |||||||||||||||| || | | || ||||||| |||||||||| |
|
|
| T |
31197906 |
acaatcccaccaaactgacttgtgaggtgaggattgtctccacttacaaacacattgtcaggccatcacctatctgatgtgggactcttaaca |
31197814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 38476336 - 38476284
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
38476336 |
acaaccccacaaaatcggcttgtgaggtgaggatttcccccacttataaacac |
38476284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 3157352 - 3157414
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctcc-acttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
3157352 |
acaaccccacaaaacag-cttgtgaggtgaggattgccccccacttataaacacattgtcaggc |
3157414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 80
Target Start/End: Original strand, 4873723 - 4873776
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
4873723 |
cacaaaaccggcttgtgaggtgagaattgcc-acacttataaacacattgtcagg |
4873776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 12688125 - 12688071
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
12688125 |
ccacaaaaccggcttgtgaggtggggattgccctcacttataaacacattatcag |
12688071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 15042911 - 15042969
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtc |
77 |
Q |
| |
|
|||||||||||||||||| || ||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
15042911 |
acaaccccacaaaaccggtttacgaggtaaggattgcccccacttataaacacattgtc |
15042969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 27439572 - 27439634
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||| |||||||||| |||||||||| |||||||| | | |||||||||||||||||||||| |
|
|
| T |
27439572 |
acaacgccacaaaaccagcttgtgaggcgaggattgaccctacttataaacacattgtcaggc |
27439634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 73
Target Start/End: Original strand, 31079603 - 31079641
Alignment:
| Q |
35 |
ggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31079603 |
ggcttgtgaggtgaggattgcctccacttataaacacat |
31079641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 36917464 - 36917526
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||| | ||||||| ||||||||| || ||||||||||| |||||||||||| |
|
|
| T |
36917464 |
acaaccccacaaaactgacttgtgatgtgaggattacccccacttataaatacattgtcaggc |
36917526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 25 - 71
Target Start/End: Original strand, 37868379 - 37868425
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
37868379 |
ccacaaaaccggcttgtgaggtgaggattgcccccactaataaacac |
37868425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 70
Target Start/End: Original strand, 6559476 - 6559525
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
6559476 |
aacctcacaaaaccggcttgtaaggtgaggattgcccccacttataaaca |
6559525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 38 - 107
Target Start/End: Original strand, 34236692 - 34236761
Alignment:
| Q |
38 |
ttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| | || || | |||||||||| |||||| |
|
|
| T |
34236692 |
ttgtgaggtgaggattgctcccacttataaacacattgtcagaccatctcttatccgatgtggcactctt |
34236761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 38 - 111
Target Start/End: Original strand, 39052581 - 39052654
Alignment:
| Q |
38 |
ttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||| || | | || ||||||| |||||||||| |
|
|
| T |
39052581 |
ttgttaggtgaggattgcccccacttataaacacattgtcaggccatcacctatctgatgtgggactcttaaca |
39052654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 5675759 - 5675819
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||| |||||||| | |||||||||||||| |||| ||| |||||||||||||||||||| |
|
|
| T |
5675759 |
acaactccacaaaatcagcttgtgaggtgagaattgtctctacttataaacacattgtcag |
5675819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 8466749 - 8466801
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| | |||||||||||||| |
|
|
| T |
8466749 |
acaaccccataaaaccagcttgtgaggtgaggattgtccccacttataaacac |
8466801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 75
Target Start/End: Original strand, 30966100 - 30966148
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattg |
75 |
Q |
| |
|
||||||||||||||| ||||||||| |||| |||||||||||||||||| |
|
|
| T |
30966100 |
acaaaaccggcttgtaaggtgaggactgcccccacttataaacacattg |
30966148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 34653209 - 34653150
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||||||||||||| || |||||| ||| |||||||||||| |||||||| |
|
|
| T |
34653209 |
acaaccccacaaaaccggcttgtgatgttaggattacct-cacttataaacaaattgtcag |
34653150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 24 - 80
Target Start/End: Complemental strand, 42584728 - 42584672
Alignment:
| Q |
24 |
cccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||| ||||| || ||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
42584728 |
cccacaaaatcggctggtaaggtgagtattgcccccacttataaacacattgtcagg |
42584672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 71
Target Start/End: Original strand, 44931215 - 44931259
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
44931215 |
acaaaaccggcttgtgaggcgaggattgcccccacttataaacac |
44931259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 5940117 - 5940058
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
5940117 |
acaaccctacaaaacttgcttgtgaggtgaggattgtccccatttataaacacattgtca |
5940058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 18939322 - 18939373
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
|||||| ||||||| | ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18939322 |
acaacctcacaaaatcagcttgtgaggtgaggattgcccccacttataaaca |
18939373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 16050319 - 16050258
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| | |||||||||| | |||||||||| |
|
|
| T |
16050319 |
acaaccccacaaaaccggctt-tgaggtgaggattgtcctcacttataaataaattgtcaggc |
16050258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 107
Target Start/End: Original strand, 30201555 - 30201637
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||| |||| || || || || | |||||||||| |||||| |
|
|
| T |
30201555 |
ccacaaaaccggcttgtgaggtgaagattgaccccacttataaacttattgccatgccatctcttatccgatgtgggactctt |
30201637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 71
Target Start/End: Original strand, 37867863 - 37867909
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||| |||||||| |
|
|
| T |
37867863 |
ccacaaaaccggcttgtgaggtgagaattgcccccactaataaacac |
37867909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 71
Target Start/End: Original strand, 37868103 - 37868149
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
37868103 |
ccacaaaaccggcttgtgtggtgaggattgcccccactaataaacac |
37868149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 107
Target Start/End: Original strand, 37868614 - 37868696
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||| | |||||||||| |||||| || |||||||||||| |||||| |
|
|
| T |
37868614 |
ccacaaaaccagcttgtgaggtgaggattgcccccattaataaacacatgttcaggccatcatttgtccgatgtgggactctt |
37868696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 6541974 - 6541881
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggatt-gcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| || |||||||||| ||| | |||||| || ||| ||| |||||| |||||||||| |
|
|
| T |
6541974 |
acaaacccacaaaaccggcttgtgaggtgaggattaccccccacttataagcacttgttcaggccatctcacttccaatgtgggactcttaaca |
6541881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 15797075 - 15797132
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| |||||||||||||||||| |
|
|
| T |
15797075 |
acaaccccacaaaacctgcgtgtgaggtgaggattgttctcacttataaacacattgt |
15797132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 20702856 - 20702763
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||||||| || ||||||||||||| | |||||||| | || | ||||||||| |||||||||| |
|
|
| T |
20702856 |
acaacctcacaaaaccggcttatgagatgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcttaaca |
20702763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 70
Target Start/End: Original strand, 31079365 - 31079414
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
31079365 |
aaccccgcaaaaccggcttgtgaggtgaggattgccctcacttctaaaca |
31079414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 73
Target Start/End: Complemental strand, 40014712 - 40014663
Alignment:
| Q |
24 |
cccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||||||||| ||||||| |||| ||||||| |||||||||||||||| |
|
|
| T |
40014712 |
cccacaaaaccgacttgtgaagtgaagattgcccccacttataaacacat |
40014663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 422478 - 422538
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||| |||||| |||| ||| |||||| | |||||||||||| |||||||| |
|
|
| T |
422478 |
acaaccccacaaaatcggcttatgagctgatgattgcatacacttataaacatattgtcag |
422538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 35 - 79
Target Start/End: Original strand, 28213145 - 28213188
Alignment:
| Q |
35 |
ggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28213145 |
ggcttgtgaggtgaggattgcc-gcacttataaacacattgtcag |
28213188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 47 - 79
Target Start/End: Original strand, 36917310 - 36917342
Alignment:
| Q |
47 |
gaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36917310 |
gaggattgcctccacttataaacacattgtcag |
36917342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 27 - 70
Target Start/End: Original strand, 45031394 - 45031437
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
||||||||||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
45031394 |
acaaaaccggcttgtaaggtgaggattgccccgacttataaaca |
45031437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 3157034 - 3157091
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgt |
76 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
3157034 |
acaaccccacaaaacat-cttgtgaggtgaggattgccccccacttataaacacattgt |
3157091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 3961426 - 3961484
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||| | ||||||||||| ||||| ||| |||||||||||||||||| |
|
|
| T |
3961426 |
aaccccacaaaaccagtttgtgaggtgataattgctcccatttataaacacattgtcag |
3961484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 10614964 - 10615018
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| || ||| || ||||||||| |
|
|
| T |
10614964 |
acaaccccacaaaatcggcttgtgaggtgaagattacccccatttgtaaacacat |
10615018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 15686065 - 15686119
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
15686065 |
acaatcccacaaaaccggcttgtgaggtgagaatttttcccacttataaacacat |
15686119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 79
Target Start/End: Original strand, 28213352 - 28213406
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||| ||||||||||||| | || | ||||||||||| |||||||||| |
|
|
| T |
28213352 |
ccacaaaaccgacttgtgaggtgagaaatgtccccacttataaatacattgtcag |
28213406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 48
Target Start/End: Complemental strand, 4963413 - 4963384
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtga |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4963413 |
acaaccccacaaaaccggcttgtgaggtga |
4963384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 21 - 78
Target Start/End: Complemental strand, 7669476 - 7669419
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||||||||| | |||| || ||| ||||||| |||||||||||||| |||||| |
|
|
| T |
7669476 |
aaccccacaaaaccagtttgtaagatgatgattgcccccacttataaacacgttgtca |
7669419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 3183929 - 3183961
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
3183929 |
acaaaaccggcttgtaaggtgaggattgcctcc |
3183961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 4195968 - 4196000
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
4195968 |
acaaaaccggcttgtaaggtgaggattgcctcc |
4196000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 107
Target Start/End: Complemental strand, 6463017 - 6462930
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
|||||| ||||||||| | |||| | | |||| ||||||||||||||||||||||||||| | || || | ||||||||| ||||||| |
|
|
| T |
6463017 |
acaaccgcacaaaacctgtttgttaagcgagg-ttgcctccacttataaacacattgtcaagtcatctcttatccgatgtgaaactctt |
6462930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 8559667 - 8559635
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
8559667 |
acaaaaccggcttgtaaggtgaggattgcctcc |
8559635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 10989052 - 10989084
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
10989052 |
acaaaaccggcttgtaaggtgaggattgcctcc |
10989084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 10989259 - 10989291
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
10989259 |
acaaaaccggcttgtaaggtgaggattgcctcc |
10989291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 15011047 - 15011079
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
15011047 |
acaaaaccggcttgtaaggtgaggattgcctcc |
15011079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 16454653 - 16454685
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
16454653 |
acaaaaccggcttgtaaggtgaggattgcctcc |
16454685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 31197674 - 31197614
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||| ||||||||| ||| ||||||||| ||| || |||||||||||||||||||| |
|
|
| T |
31197674 |
acaaccctacaaaaccgacttttgaggtgagaattacccttacttataaacacattgtcag |
31197614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 36907453 - 36907513
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||| |||| ||||||| | ||||| |||||| |||||| | ||||||||||||| |
|
|
| T |
36907453 |
acaaccccaccaaactggcttgtaatgtgagaattgcccccacttttgaacacattgtcag |
36907513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 40902411 - 40902443
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
40902411 |
acaaaaccggcttgtaaggtgaggattgcctcc |
40902443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 43599397 - 43599365
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
43599397 |
acaaaaccggcttgtaaggtgaggattgcctcc |
43599365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 67
Target Start/End: Original strand, 45031185 - 45031225
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataa |
67 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
45031185 |
acaaaaccggcttgaaaggtgaggattacctccacttataa |
45031225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 77; Significance: 7e-36; HSPs: 109)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 41666782 - 41666874
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
41666782 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
41666874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 41667018 - 41667110
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
41667018 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
41667110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 24346526 - 24346618
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| | |||||||||| |||||||||| |
|
|
| T |
24346526 |
acaaccccataaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
24346618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 8081138 - 8081231
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctcc-acttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||| ||||| | |||||||||| |||||||||| |
|
|
| T |
8081138 |
acaaccccacaaaaccggcttgtgagatgaggattgccccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
8081231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 9368654 - 9368562
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || || | |||||||| |||||||||| |
|
|
| T |
9368654 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcacgccatctcctatccgatgtatgactcttaaca |
9368562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 24269896 - 24269987
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| | |||||||||| |||||||||| |
|
|
| T |
24269896 |
acaaccccataaaaccggcttgtgaggtgaggattacc-ccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
24269987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 15480618 - 15480524
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg--cctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||| ||||||| || ||||||| |||||||||| |
|
|
| T |
15480618 |
acaaccccacaaaaccggcttgtgaggtgaggattgatcccccacttataaacacgttgtcaggccatgtcatatctgatgtgggactcttaaca |
15480524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 24346762 - 24346855
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| || ||||||||||| |||||||||||| ||||| | | |||||||| ||||||||||| |
|
|
| T |
24346762 |
acaaccccacaaaaccggcttgtgaggtgagtattacccccacttataaatacattgtcaggccatgtcttattcgatgtgggactcttaacaa |
24346855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 18333490 - 18333582
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| | || || | |||||||||| | |||||||| |
|
|
| T |
18333490 |
acaaccccacaaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcagaccatctcctatccgatgtgggattcttaaca |
18333582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 19705962 - 19705870
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||| ||||||||||||||| | |||||||||||||| |||||||||||||||||||||||| ||||| | ||||||||| |||||||||| |
|
|
| T |
19705962 |
acaactccacaaaaccggcttataaggtgaggattgcccccacttataaacacattgtcaggctatgtcctacccgatgtgggactcttaaca |
19705870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 24528599 - 24528539
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24528599 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcag |
24528539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 25258326 - 25258418
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||| ||||||| ||||| |||| ||||| ||||| |||||| |||||||||| |
|
|
| T |
25258326 |
acaaccccacaaaaccgacttgtgaggtgaggattgcccccactgataaacatattgttaggccatgtcctgtccaatgtgggactcttaaca |
25258418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 25322116 - 25322208
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||| ||||||| ||||| |||| ||||| ||||| |||||| |||||||||| |
|
|
| T |
25322116 |
acaaccccacaaaaccgacttgtgaggtgaggattgcccccactgataaacatattgttaggccatgtcctgtccaatgtgggactcttaaca |
25322208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 2063759 - 2063852
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||| | |||| | |||||||||| |||||||||||| |
|
|
| T |
2063759 |
acaaccccacaaaaccgacttgtgag-tgaggattgcccccacttataaacacattgtcagaccatgttctatccgatgtgggactcttaacaat |
2063852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 8098376 - 8098283
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||||| |
|
|
| T |
8098376 |
acaaccccacaaaaccggcttgtgaggtgaggattgcc-ccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaacaat |
8098283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 24531658 - 24531597
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24531658 |
acaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaacacattgtcagg |
24531597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 24647755 - 24647663
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||| |||||||||||||||| ||| || | | |||||||||| |||||||||| |
|
|
| T |
24647755 |
acaactccacaaaaccggcttgtgaggtgaggattgccaccagttataaacacattgtccggccatcacctatccgatgtgggactcttaaca |
24647663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 21 - 84
Target Start/End: Complemental strand, 60144 - 60081
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaat |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
60144 |
aaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacatgttcaggcaat |
60081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 15480379 - 15480321
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15480379 |
aaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacattgtcag |
15480321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 21209946 - 21210040
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | ||||||||||||| |||||||||| | || | ||||||||| |||||||||||| |
|
|
| T |
21209946 |
acaaccccacaaaaccggcttgtgaggtgagaattgtccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaacaat |
21210040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 24270130 - 24270224
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtc-atgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| || ||||||||||| |||||||||||| ||||| | | |||||||| ||||||||||| |
|
|
| T |
24270130 |
acaaccccacaaaaccggcttgtgaggtgagtattacccccacttataaatacattgtcaggccatgtctttattcgatgtgggactcttaacaa |
24270224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 27133018 - 27133080
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
27133018 |
acaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcaggc |
27133080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 95291 - 95352
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
95291 |
acaaccccacaaaaccggcttgtgagatgaggattgtccccacttataaacacattgtcagg |
95352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 6413451 - 6413512
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6413451 |
acaaccccacaaaatcggcttatgaggtgaggattgcccccacttataaacacattgtcagg |
6413512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 21306946 - 21306865
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtgg |
100 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||| ||||||||||| |||||| ||| | ||||| |||||||||||| |
|
|
| T |
21306946 |
acaatcccacaataccggcttgtgaggtgaggattgcccccacttataaatacattggcagaccatgtcctgtccgatgtgg |
21306865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 21314784 - 21314703
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtgg |
100 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||| ||||||||||| |||||| ||| | ||||| |||||||||||| |
|
|
| T |
21314784 |
acaatcccacaataccggcttgtgaggtgaggattgcccccacttataaatacattggcagaccatgtcctgtccgatgtgg |
21314703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 28510150 - 28510089
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
28510150 |
acaaccccacaaaaccggcttatgagatgaggattgccttcacttataaacacattgtcagg |
28510089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 27 - 100
Target Start/End: Original strand, 30758332 - 30758405
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtgg |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||| || ||||||||||||||||||||| ||||| | |||||||||| |
|
|
| T |
30758332 |
acaaaaccggcttatgaggtgaggattgcccccccttataaacacattgtcaggccatgtcctatccgatgtgg |
30758405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 8098610 - 8098518
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || | |||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
8098610 |
acaaccccacaaaaccggcttgtgaggtgaggattgtctgcgcttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
8098518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 107
Target Start/End: Complemental strand, 15438936 - 15438848
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
||||||| | |||| ||||||||||||||||||||||| ||||||||||||||||| |||| | || |||| ||||||||| ||||||| |
|
|
| T |
15438936 |
acaaccctagaaaatcggcttgtgaggtgaggattgcccccacttataaacacattatcagaccatctcatatccgatgtgaaactctt |
15438848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 17352461 - 17352521
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
17352461 |
caacctcacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcagg |
17352521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 2061963 - 2062030
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgt |
86 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| ||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
2061963 |
acaaccacacaagaccggcttgtgaggtgaagattgcccccacttataaacacattgtcaggccatgt |
2062030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 30 - 113
Target Start/End: Complemental strand, 6637650 - 6637568
Alignment:
| Q |
30 |
aaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||| || || | ||||||||| |||||||||||| |
|
|
| T |
6637650 |
aaaccggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatttcctaaccgatgtgg-actcttaacaat |
6637568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 6413682 - 6413775
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||| | | ||||||||||||||||||| | || |||| |||||||||| |||||||||||| |
|
|
| T |
6413682 |
acaaccccaaaaaaccggcttatgaggtgaggattgtccctacttataaacacattgtcaatc-atctcatatccgatgtgggactcttaacaat |
6413775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 109
Target Start/End: Complemental strand, 9368889 - 9368799
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaa |
109 |
Q |
| |
|
||||||||||| || |||||||||| ||||| |||||| ||||||||||||||||||||| || || || | |||||||||| |||||||| |
|
|
| T |
9368889 |
acaaccccacataatcggcttgtgaagtgagaattgcccccacttataaacacattgtcatgccatctcctatccgatgtgggactcttaa |
9368799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 19522146 - 19522084
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||| ||||| |
|
|
| T |
19522146 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccactaataaacaaattgacaggc |
19522084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 32908745 - 32908803
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||| ||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32908745 |
aacccctcaaaaccggtttgtgaggtgatgattgcctccacttataaacacattgtcag |
32908803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 29909746 - 29909795
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaa |
68 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29909746 |
acaactccacaaaaccggcttgtgaggtgaggattgcctccacttataaa |
29909795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 43117941 - 43117848
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatg-tggaactcttaaca |
111 |
Q |
| |
|
||||||| | |||||||||||||||| ||||||||||| || |||||||||||||||||||| ||||| ||||||| | ||| |||||||||| |
|
|
| T |
43117941 |
acaaccctataaaaccggcttgtgagatgaggattgccctcatttataaacacattgtcaggccatgtcctgtccgaagttgggactcttaaca |
43117848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 107
Target Start/End: Original strand, 1564592 - 1564680
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
||||||||||||||| | ||||||| |||||||||||| |||||||||| ||||||||||| | || || | |||||||||| |||||| |
|
|
| T |
1564592 |
acaaccccacaaaactgtcttgtgatgtgaggattgcccccacttataatcacattgtcagaccatctcttatccgatgtgggactctt |
1564680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 7369783 - 7369731
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
7369783 |
acaaccccacaaaaccggcttgtgaggtgaggactgcccccacttataaacac |
7369731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 30770082 - 30770166
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||| || |||||||||||||||| |||||| |||| ||||||||||| ||||| | |||||||||| |||||||||| |
|
|
| T |
30770082 |
acaaaaccggtttatgaggtgaggattgcccccacttttaaaaacattgtcaggtcatgtcctatccgatgtgggactcttaaca |
30770166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 20 - 79
Target Start/End: Original strand, 37782076 - 37782135
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||| |||||||||| ||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
37782076 |
caactccacaaaaccagcttgtgaggtgatgattgcccccacttataaacacattgtcag |
37782135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 170576 - 170630
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
170576 |
acaacctcacaaaaccggcttgtgaggtgaggactgcccccacttataaacacat |
170630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 7607653 - 7607595
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtc |
77 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||| ||||||||||||||| |||||| |
|
|
| T |
7607653 |
acaactccacaaaaccggcttgtgaggtgaagattgtctccacttataaacagattgtc |
7607595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 29909512 - 29909574
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
29909512 |
acaatcccacaaaaccgatttgtgaggtgaggattgcctccacttataaataaattgtcaggc |
29909574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 37656964 - 37657022
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||| |||||||||| |||||| || |||||||||||||||||||||| |
|
|
| T |
37656964 |
aaccccacaaaaccgacttgtgaggtaaggattacccccacttataaacacattgtcag |
37657022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 25 - 87
Target Start/End: Complemental strand, 38976986 - 38976924
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtc |
87 |
Q |
| |
|
|||||||||||| ||||||||||||||||| | | |||||||||||||||||||| ||||||| |
|
|
| T |
38976986 |
ccacaaaaccggtttgtgaggtgaggattgtcccaacttataaacacattgtcagacaatgtc |
38976924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 42295638 - 42295576
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||| |
|
|
| T |
42295638 |
acaactccacaaaaccggcttgtgaggtgaggattgctcccacttataaacaaattatcaggc |
42295576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 75
Target Start/End: Complemental strand, 8287860 - 8287805
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattg |
75 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||||||| |||| |
|
|
| T |
8287860 |
acaaccccacaaaaccggcttgtgaggtggggattgcc-ccacttataaacaaattg |
8287805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 13296951 - 13296891
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||| ||||| ||||||||||||| |||||||| |
|
|
| T |
13296951 |
acaatcccacaaaaccggtttgtgaggtgagggttgcccccacttataaacaaattgtcag |
13296891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 17150266 - 17150350
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||| || | ||||||||||||||||| ||||||||||||||||| |||| | || || | |||||||| |||||||||||| |
|
|
| T |
17150266 |
acaaaactggttggtgaggtgaggattgcccccacttataaacacattttcagaccatctcctatccgatgttgaactcttaaca |
17150350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 20510667 - 20510759
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||| ||||||||| || || |||||||||||||||| ||||||||||||| |||||||||| || | | |||||||||| ||||||||| |
|
|
| T |
20510667 |
acaactccacaaaactggtttttgaggtgaggattgcccccacttataaacatattgtcaggccatcacctatccgatgtggggctcttaaca |
20510759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 24487670 - 24487730
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| || ||||||||||||| ||| |||| |
|
|
| T |
24487670 |
acaacctcacaaaaccggcttgtgaggtgaggattacccccacttataaacatattttcag |
24487730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 63
Target Start/End: Original strand, 25258119 - 25258163
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccactt |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25258119 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccactt |
25258163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 63
Target Start/End: Original strand, 25321909 - 25321953
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccactt |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25321909 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccactt |
25321953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 87
Target Start/End: Original strand, 30770298 - 30770358
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtc |
87 |
Q |
| |
|
|||||||| |||| |||||||||||||||| ||||||||||||||||||||| || ||||| |
|
|
| T |
30770298 |
acaaaaccagcttatgaggtgaggattgcccccacttataaacacattgtcaagccatgtc |
30770358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 37781778 - 37781726
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37781778 |
ccacaaaaccgacttgtgaggtgaggattg--tccacttataaacacattgtcag |
37781726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 24 - 78
Target Start/End: Complemental strand, 13296727 - 13296673
Alignment:
| Q |
24 |
cccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||| | ||||||| |
|
|
| T |
13296727 |
cccacaaaactggcttgtgaggtgaggattgcccccacttataaataaattgtca |
13296673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 108
Target Start/End: Original strand, 18333724 - 18333814
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggatt-gcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| || |||||||||||||||||| |||| || || | || ||||||| ||||||| |
|
|
| T |
18333724 |
acaaccccacaaaaccggcttgtgaggtgacgattaccccccacttataaacacattgcaaggccatctcctatctgatgtgggactctta |
18333814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 30 - 111
Target Start/End: Complemental strand, 6637885 - 6637804
Alignment:
| Q |
30 |
aaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||| ||||||||||||| || || | ||||||||| |||||||||| |
|
|
| T |
6637885 |
aaaccggtttgtgaggtgaggattgcacccacttatagacacattgtcaggtcatctcctaaccgatgtgggactcttaaca |
6637804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 6919227 - 6919280
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||||||| | |||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
6919227 |
acaaaaccggcttttaaggtgaggattgcccccactaataaacacattgtcagg |
6919280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 15590233 - 15590140
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||| |||||||||||||| ||||||||| | || |||| | ||||||| |||||||||| |
|
|
| T |
15590233 |
acaaccccacaaaatcagcctgtgaggtgaggattgccctccacttataaatccattgtcagaccatctcatattcgatgtgagactcttaaca |
15590140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 17015904 - 17015961
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||| |||||||||||| ||||| |
|
|
| T |
17015904 |
acaaccccacaaaatcggcttgtgaggtgagaattgccctcacttataaacatattgt |
17015961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 73
Target Start/End: Complemental strand, 25436259 - 25436206
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
25436259 |
caaccccacaaaaccggcttgtgaggtgaggatttcccttacttataaacacat |
25436206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 111
Target Start/End: Original strand, 33337270 - 33337355
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||| ||| ||||||||||| ||||||| ||||||||||||| |||||||||| || | | ||| |||||| |||||||||| |
|
|
| T |
33337270 |
cacaaaatcggtttgtgaggtgatgattgcccccacttataaacatattgtcaggccatcacctatccaatgtgggactcttaaca |
33337355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 25 - 113
Target Start/End: Complemental strand, 37656666 - 37656580
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
||||||||||||||||||| ||||||||| | |||||||||||||||||||||| | || | | ||||| |||| |||||||||||| |
|
|
| T |
37656666 |
ccacaaaaccggcttgtgatgtgaggatttc--ccacttataaacacattgtcagaccattacctatccgacgtgggactcttaacaat |
37656580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 111
Target Start/End: Original strand, 4481604 - 4481680
Alignment:
| Q |
35 |
ggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||| |||||||||||| ||| |||||||||||||||||||| | | | |||||||||| |||||||||| |
|
|
| T |
4481604 |
ggcttgtgacgtgaggattgcccccatttataaacacattgtcaggccaacttctatccgatgtgggactcttaaca |
4481680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 111
Target Start/End: Complemental strand, 12034741 - 12034657
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||| ||||||||||||||||||| || ||| |||||||||| ||| ||||| || || | |||||| ||| |||||||||| |
|
|
| T |
12034741 |
acaaaactggcttgtgaggtgaggatttcccccatttataaacacgttggcaggccatctcttatccgatatgggactcttaaca |
12034657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 15439046 - 15438986
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||| ||||| | |||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
15439046 |
acaaccccataaaactgacttgtgaggtgatgattgcccccacttatagacacattgtcag |
15438986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 37405148 - 37405096
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||| ||||||| |||||| |
|
|
| T |
37405148 |
acaaccccacaaaaccggcttttgaggtggggattgcccccacttacaaacac |
37405096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 62
Target Start/End: Complemental strand, 7092208 - 7092165
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccact |
62 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
7092208 |
acaaccccacaaaactggcttgtgaggtgaggattgcccccact |
7092165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 17017115 - 17017174
Alignment:
| Q |
18 |
aacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtc |
77 |
Q |
| |
|
|||||| |||| |||||| |||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
17017115 |
aacaacaccactaaaccgacttgtgaggtgatgattgaccccacttataaacacattgtc |
17017174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 18885522 - 18885460
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtg--aggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||| ||||||||| |||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
18885522 |
acaactccacaaaactggcttgtgtgaggtgagggttgtctccacttataaacacattgtcag |
18885460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 36 - 111
Target Start/End: Complemental strand, 24528816 - 24528742
Alignment:
| Q |
36 |
gcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||| | ||||||| ||||||||| |||||||||||||| ||||| | || ||||||| |||||||||| |
|
|
| T |
24528816 |
gcttgtgaggttatgattgcc-ccacttatatacacattgtcaggccatgtcctctcagatgtgggactcttaaca |
24528742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 16707050 - 16707104
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||| ||||||| ||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
16707050 |
acaaccctgcaaaaccagcttgtgaggttaggattgcccccacttataaacacat |
16707104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 23 - 73
Target Start/End: Complemental strand, 29434130 - 29434081
Alignment:
| Q |
23 |
ccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
29434130 |
ccccacaaaaccggcttgtgaggtgaggacggcc-ccacttataaacacat |
29434081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 59
Target Start/End: Original strand, 15510521 - 15510554
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
15510521 |
cacaaaaccggcttgtgaggtgaggattgcctcc |
15510554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 20225100 - 20225039
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| | || ||||||||||| ||||||| |
|
|
| T |
20225100 |
acaaccccacaaaatcgacttgtgaggtgaggattgtcctcatttataaacacactgtcagg |
20225039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 70
Target Start/End: Original strand, 26137136 - 26137185
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||| ||| ||||||||| |
|
|
| T |
26137136 |
aaccccacaaaaccggtttgtgagatgaggattgcccccatttataaaca |
26137185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 35167420 - 35167481
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||||||| ||| ||||||| || |||||||| | ||||||||||||||||||||| |
|
|
| T |
35167420 |
acaaccccacaaattcggtttgtgagatggggattgccccaacttataaacacattgtcagg |
35167481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 19522379 - 19522320
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||| ||||||||||| | |||||||| |
|
|
| T |
19522379 |
acaaccccacaaaatcggcttgtgaggtgattattgcc-ccacttataaataaattgtcag |
19522320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 38731863 - 38731923
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||| ||||||| || |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38731863 |
acaacctcacaaaatcgacttgtgaggtgaggattgttctcacttataaacacattgtcag |
38731923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 6919454 - 6919512
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||| |||||||| | ||||||||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
6919454 |
acaacctcacaaaactg-cttgtgaggtgagaattgtccccacttataaacacattgtca |
6919512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 13700614 - 13700673
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||| |||||||||||||| ||||||||| |||| | ||||||||||||||||||| |
|
|
| T |
13700614 |
acaacctcacaaaaccggcttttgaggtgagaattgtccaaacttataaacacattgtca |
13700673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 22 - 77
Target Start/End: Original strand, 13701096 - 13701151
Alignment:
| Q |
22 |
accccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtc |
77 |
Q |
| |
|
|||||||||||||| || || |||||| |||||| |||||||||||||||||||| |
|
|
| T |
13701096 |
accccacaaaaccgactcttggggtgagaattgcccccacttataaacacattgtc |
13701151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 76
Target Start/End: Original strand, 17352695 - 17352750
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
|||||| ||||| |||||||||||||| |||| || ||||||||||||||||||| |
|
|
| T |
17352695 |
aaccccgcaaaattggcttgtgaggtgaagattacccccacttataaacacattgt |
17352750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 73
Target Start/End: Original strand, 17899492 - 17899539
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||| ||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
17899492 |
cacaaaatcggctcatgaggtgaggattgcccccacttataaacacat |
17899539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 54
Target Start/End: Original strand, 21209733 - 21209768
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21209733 |
acaaccccacaaaaccggcttgtgaggtgagaattg |
21209768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 111
Target Start/End: Original strand, 3859351 - 3859425
Alignment:
| Q |
37 |
cttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||| ||||| |||| | |||||| ||| |||||||||| |
|
|
| T |
3859351 |
cttgtgaggtgaggattgtcctcacttataaacacattatcaggtcatgttctatccgatatgggactcttaaca |
3859425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 16571487 - 16571545
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||| || ||||||||||||| || ||||||| |||||||||||||| |
|
|
| T |
16571487 |
aaccccacaaaaccaatttatgaggtgaggatttcccccacttaaaaacacattgtcag |
16571545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 69
Target Start/End: Original strand, 24792281 - 24792327
Alignment:
| Q |
23 |
ccccacaaaaccggcttgtgaggtgaggattgcctccacttataaac |
69 |
Q |
| |
|
|||||||||||||| |||| ||||||||| ||||||| ||||||||| |
|
|
| T |
24792281 |
ccccacaaaaccggtttgtaaggtgaggagtgcctcctcttataaac |
24792327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 33337480 - 33337568
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| ||||||| | ||||||||||| || | | |||||||||| |||||||||| |
|
|
| T |
33337480 |
acaaccccacaaaaccggtttgtgagatgaggattgcc-ccacttaca---acattgtcaggtcatcacctatccgatgtgggactcttaaca |
33337568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 38 - 79
Target Start/End: Original strand, 2985272 - 2985313
Alignment:
| Q |
38 |
ttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||||||||| |
|
|
| T |
2985272 |
ttgtgaggtgaggattacccccaattataaacacattgtcag |
2985313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 21 - 70
Target Start/End: Complemental strand, 10509278 - 10509229
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
|||| ||||||||||| || ||| ||||| |||||||||||||||||||| |
|
|
| T |
10509278 |
aacctcacaaaaccggtttttgatgtgagtattgcctccacttataaaca |
10509229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 27 - 64
Target Start/End: Complemental strand, 15287139 - 15287102
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccactta |
64 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
15287139 |
acaaaaccggcttgtaaggtgaggattgcctcctctta |
15287102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 36040371 - 36040420
Alignment:
| Q |
30 |
aaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||| ||| ||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
36040371 |
aaaccagctcgtgaggtgatgattgcccccacttatatacacattgtcag |
36040420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 48122 - 48154
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
48122 |
acaaaaccggcttgtaaggtgaggattgcctcc |
48154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 48329 - 48361
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
48329 |
acaaaaccggcttgtaaggtgaggattgcctcc |
48361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 2908580 - 2908612
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
2908580 |
acaaaaccggcttgtaaggtgaggattgcctcc |
2908612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 2908787 - 2908819
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
2908787 |
acaaaaccggcttgtaaggtgaggattgcctcc |
2908819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 13413670 - 13413638
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
13413670 |
acaaaaccggcttgtaaggtgaggattgcctcc |
13413638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 28156116 - 28156084
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
28156116 |
acaaaaccggcttgtaaggtgaggattgcctcc |
28156084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 31974275 - 31974239
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgc |
55 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
31974275 |
acaaccccacaaaactggcttgtgcggtgaggattgc |
31974239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 71
Target Start/End: Complemental strand, 31974487 - 31974443
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||| |||| |||||||||||| |||| |||||||||||||| |
|
|
| T |
31974487 |
acaaaactggctcgtgaggtgaggactgcccccacttataaacac |
31974443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 35527006 - 35527038
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
35527006 |
acaaaaccggcttgtaaggtgaggattgcctcc |
35527038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 35527292 - 35527324
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
35527292 |
acaaaaccggcttgtaaggtgaggattgcctcc |
35527324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 37656750 - 37656782
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
37656750 |
acaaaaccggcttgtaaggtgaggattgcctcc |
37656782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 38731628 - 38731720
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| || |||| |||||||||||||| |||||| |||||||||| | ||||||||| || || | ||||||||||||| ||||||| |
|
|
| T |
38731628 |
acaacctcataaaatcggcttgtgaggtggtgattgctctcacttataaataaattgtcaggtcatctcctatccgatgtggaacacttaaca |
38731720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0519 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: scaffold0519
Description:
Target: scaffold0519; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 2210 - 2118
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
2210 |
acaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
2118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0519; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 1975 - 1883
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| | ||||| |||||||||||| |||||||||| |
|
|
| T |
1975 |
acaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcagaccatgtcctgtccgatgtgggactcttaaca |
1883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 110)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 21861588 - 21861496
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
21861588 |
acaaccccacaaaatcggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtggaactcttaaca |
21861496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 29469664 - 29469572
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
29469664 |
acaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
29469572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 29469899 - 29469807
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
29469899 |
acaactccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
29469807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 21861353 - 21861261
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
21861353 |
acaatcccacaaaaccggcttgtaaggtgaggattgccctcacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
21861261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 36277251 - 36277343
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||| |||||||||||||||||||||||| ||||| ||||||||||| |||||||||| |
|
|
| T |
36277251 |
acaaccccacaaaatcgacttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcttgtccgatgtgagactcttaaca |
36277343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 1596652 - 1596561
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||| |||||||| ||||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
1596652 |
acaaccccacaaa-ccggcttgtaaggtgaggattgcccccacttattaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
1596561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 1596887 - 1596795
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| ||||||||||| ||||||| |||| ||||| |||||||||||| |||||||||| |
|
|
| T |
1596887 |
acaaccctacaaaaccggcttgtaaggtgaggattgcccccacttataaaaacattgttaggccatgtcctgtccgatgtgggactcttaaca |
1596795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 21054978 - 21055071
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| || | | |||||| ||| ||||||||||| |
|
|
| T |
21054978 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacatattgtcaggccatcacctatccgatatgggactcttaacaa |
21055071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 25620195 - 25620134
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25620195 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagg |
25620134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 48243086 - 48243176
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | | |||| || ||||||| |||||||||| |
|
|
| T |
48243086 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagacca--tcatatctgatgtgggactcttaaca |
48243176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 3038109 - 3038201
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| || |||| || | | |||||||| |||||||||| |
|
|
| T |
3038109 |
acaaccccacaaaaccggcttgtgacgtgaggattgcccccacttataaacacattgttagacaatctcttattcgatgtgggactcttaaca |
3038201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 26239941 - 26240033
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||| |||||||||||||||||||||| | ||||| | |||||||| | |||||||||| |
|
|
| T |
26239941 |
acaaccccacaataccgacttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctatccgatgtcggactcttaaca |
26240033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 36993099 - 36993191
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| | |||||||||||||||||||| | ||||||| |||||||| |||||||||||| |
|
|
| T |
36993099 |
acaaccccacaaaaccagcttgtgaggtgagcattgctcctacttataaacacattgtcagaccatgtcatatccgatgttgaactcttaaca |
36993191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 43688185 - 43688276
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||| |||||||| ||||| ||||||||| |||||||||||||||||||||||| ||||| | |||||||||| |||||||||| |
|
|
| T |
43688185 |
acaaccccacaaa-ccggcttgagaggtaaggattgcccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
43688276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 34027452 - 34027390
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
34027452 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggc |
34027390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 48243462 - 48243555
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||| || ||| | | |||||| ||||||||||| |
|
|
| T |
48243462 |
acaaccccacaaaaccggcttgtaagatgaggattgcccccacttataaacacattgtcaggccatcacatattcaatgtgggactcttaacaa |
48243555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 36206088 - 36206180
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||| |||| | || | |||||||||||||||||||| |
|
|
| T |
36206088 |
acaaccccataaaaccggcttgtgaggtgaagattgcctccacttataaacaaattgttaggccaactcctaaccgatgtggaactcttaaca |
36206180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 47710502 - 47710410
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |||| || | | ||||||||| |||||||||| |
|
|
| T |
47710502 |
acaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaacacattgtaaggccatcacctatccgatgtgagactcttaaca |
47710410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 47722158 - 47722066
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |||| || | | ||||||||| |||||||||| |
|
|
| T |
47722158 |
acaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaacacattgtaaggccatcacctatccgatgtgagactcttaaca |
47722066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 2544472 - 2544534
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
2544472 |
acaaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaacaaattgtcaggc |
2544534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 17202238 - 17202144
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||||| |
|
|
| T |
17202238 |
acaaccccacaaaaccggcttgtgagatgagaattgcccccacttataaacaaattgtcaggccaactcttaaccgatgtgggactcttaacaat |
17202144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 34027686 - 34027624
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
34027686 |
acaaccccacaaaaccggcttgtgaagtgaggattgcccccacttataaacaaattgtcaggc |
34027624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 42985148 - 42985242
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||||| ||||||| || |||||||||||||||||||||||||||||||||||||||||| | || ||| ||||||||| |||||||||||| |
|
|
| T |
42985148 |
acaacctcacaaaatcgacttgtgaggtgaggattgcctccacttataaacacattgtcaaaccatcacatatccgatgtgagactcttaacaat |
42985242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 21 - 78
Target Start/End: Original strand, 10882032 - 10882089
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
10882032 |
aaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtca |
10882089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 107
Target Start/End: Original strand, 11211704 - 11211791
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||| || || | ||||| |||| |||||| |
|
|
| T |
11211704 |
acaaccccacaaaaccggcttgtgaggtgaggattgcc-ccacttataaagacattgttaggccatctcttatccgacgtgggactctt |
11211791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 21 - 81
Target Start/End: Original strand, 26562100 - 26562160
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
26562100 |
aaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaacaaattgtcaggc |
26562160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 4886377 - 4886310
Alignment:
| Q |
30 |
aaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatg |
97 |
Q |
| |
|
||||||||||||||||||||||||||| ||| | ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
4886377 |
aaaccggcttgtgaggtgaggattgcccccattaataaacatattgtcaggccatgtcatgtccgatg |
4886310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 32879639 - 32879702
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
32879639 |
acaaccccgcaaaaccggcttgtgaggtgaggattgccccccacttataaacacattgtcaggc |
32879702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 35 - 110
Target Start/End: Original strand, 33996120 - 33996195
Alignment:
| Q |
35 |
ggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaac |
110 |
Q |
| |
|
|||||||||||||||||||| | |||| ||||||||||||||||| ||||||| | |||||||||| ||||||||| |
|
|
| T |
33996120 |
ggcttgtgaggtgaggattgtccccacgtataaacacattgtcagacaatgtcttatccgatgtgggactcttaac |
33996195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 46452692 - 46452597
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| || ||||||||||||||||||| || ||||| | |||||||||| |||||||||||| |
|
|
| T |
46452692 |
acaaccccacaaaaccaacttgtgaggtgaggattgccccccacttataaacacattgtgtggtcatgtcctatccgatgtgggactcttaacaat |
46452597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 25 - 111
Target Start/End: Complemental strand, 31892204 - 31892118
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||| ||||||||| || || || | |||||||||| ||| |||||| |
|
|
| T |
31892204 |
ccacaaaaccggcttgtgaggtgaggattgtccccacttataaatacattgtcatgctatatcctatccgatgtgggacttttaaca |
31892118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 33996336 - 33996426
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaa |
109 |
Q |
| |
|
||||| ||||||||||| |||||||||||| ||||||| ||||||||||| ||||| | |||| ||||| | |||||||||| |||||||| |
|
|
| T |
33996336 |
acaactccacaaaaccgacttgtgaggtgaagattgcccccacttataaatacattattaggccatgtcctatccgatgtgggactcttaa |
33996426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 110 - 175
Target Start/End: Complemental strand, 19713713 - 19713648
Alignment:
| Q |
110 |
caatgtgtaagaagttttggatacaaaaactttggattcacatcctttttgccttgtcatgcaaaa |
175 |
Q |
| |
|
||||||| ||| | |||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19713713 |
caatgtgcaaggatttttggatacaataactttggattcacaacctttttgccttgtcatgcaaaa |
19713648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 26 - 111
Target Start/End: Original strand, 48661587 - 48661672
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||| ||||||||||| || || | || ||||||| |||||||||| |
|
|
| T |
48661587 |
cacaaaaccggcttgtgaggtgaggattgcccccacctataaatacattgtcaggtcatctcctatctgatgtgggactcttaaca |
48661672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 3393041 - 3392949
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||| | |||||||||||||||||||||||| || | | ||||||||| |||||||||| |
|
|
| T |
3393041 |
acaaccccacaaaatcggcttgtgaggtgagaattttccccacttataaacacattgtcaggccatcacctatccgatgtgagactcttaaca |
3392949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 27 - 79
Target Start/End: Complemental strand, 4454827 - 4454775
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4454827 |
acaaaaccggtttgtgaggtgaggattgcccccacttataaacacattgtcag |
4454775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 31485449 - 31485541
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| ||||||||| | |||||| |||||||||||| |||||||||||||||||||||||| || ||| || |||||| |||||||||| |
|
|
| T |
31485449 |
acaacctcacaaaaccagtttgtgatgtgaggattgcccccacttataaacacattgtcaggccatcacatatcttatgtgggactcttaaca |
31485541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 36277016 - 36277108
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| |||| |||||| |||||||||||||| |||| | |||||||||||||||||||||| | ||| |||||| |||||| |||||||||| |
|
|
| T |
36277016 |
acaatcccataaaacctgcttgtgaggtgagaattgtccccacttataaacacattgtcagactatgccatgtctgatgtgagactcttaaca |
36277108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 26 - 81
Target Start/End: Original strand, 31485691 - 31485746
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
31485691 |
cacaaaaccggcttgtcaggtgaggattgcccccacttataaaaacattgtcaggc |
31485746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 43075335 - 43075394
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
43075335 |
acaaccccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacgttgtca |
43075394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 43085562 - 43085621
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
43085562 |
acaaccccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacgttgtca |
43085621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 43089233 - 43089292
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
43089233 |
acaaccccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacgttgtca |
43089292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 27 - 110
Target Start/End: Original strand, 44874379 - 44874462
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaac |
110 |
Q |
| |
|
|||||| ||| |||||||||||||||| || ||||||||||||||||||||||| || || | |||||||||| ||||||||| |
|
|
| T |
44874379 |
acaaaatcggtttgtgaggtgaggatttcccccacttataaacacattgtcaggttatctcctatccgatgtgggactcttaac |
44874462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 29 - 79
Target Start/End: Original strand, 3520075 - 3520125
Alignment:
| Q |
29 |
aaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3520075 |
aaaaccggcttgcgaggtgaggattgcccccacttataaacacattgtcag |
3520125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 6634914 - 6634852
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
6634914 |
acaaccccacaaaactagcttatgaggtgaggattgcccccacttataaacaaattgtcaggc |
6634852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 27 - 113
Target Start/End: Original strand, 9689123 - 9689209
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||| |||||||||| | || | | |||||||||| |||||||||||| |
|
|
| T |
9689123 |
acaaaaccggcttgtgaggtgaggatttcccccacttataagcacattgtcaaaccatcacctatccgatgtgggactcttaacaat |
9689209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 40746324 - 40746262
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
40746324 |
acaaccccacaaaatcggcttatgaggtgaggattgccctcacttataaacaaattgtcaggc |
40746262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 10903144 - 10903051
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtg-gaactcttaaca |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| || | ||||||||||| ||||||| || ||||| | | ||||||| | |||||||||| |
|
|
| T |
10903144 |
acaactccacaaaaccggcttgtgaggtgaggattacccctacttataaacatattgtcaagccatgtcctattcgatgtgtggactcttaaca |
10903051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 23839102 - 23839159
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| || ||||||||||||| ||||| |
|
|
| T |
23839102 |
acaacctcacaaaaccggcttgtgaggtgaggatttcccccacttataaacagattgt |
23839159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 32278910 - 32278991
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtgg |
100 |
Q |
| |
|
|||||| |||||||||||||| |||||||| ||||| | |||||||||||||||||||||| | || ||| |||||||||| |
|
|
| T |
32278910 |
acaacctcacaaaaccggcttatgaggtgacgattgtccccacttataaacacattgtcagaccatcacatatccgatgtgg |
32278991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 2315295 - 2315355
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||| |||||| |||| ||||| |
|
|
| T |
2315295 |
acaaccccacaaaaccggcttatgaggtgagaattgcctccacatataaatacatagtcag |
2315355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 2544240 - 2544300
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||| ||||||| |||||| ||||||| ||||||||||||| |||||||| |
|
|
| T |
2544240 |
acaaccccacaaaactggcttgtaaggtgaagattgcccccacttataaacaaattgtcag |
2544300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 18826513 - 18826605
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| | ||||||||| |||| ||| || ||||||||||||||||||||||| || || | ||| |||||| |||||||||| |
|
|
| T |
18826513 |
acaaccccacaaaatcagcttgtgagttgagaattacccccacttataaacacattgtcaggtcatctcctatccaatgtgggactcttaaca |
18826605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 31257056 - 31257116
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||| || ||||||||||| ||||||| ||||||||||||| |||||||| |
|
|
| T |
31257056 |
acaaccccacaaaactggtttgtgaggtgaagattgcccccacttataaacaaattgtcag |
31257116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 70
Target Start/End: Complemental strand, 1793805 - 1793754
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
1793805 |
acaaccccacaaaacctgcttgtgaggtgaggattgcccccactaataaaca |
1793754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 24 - 111
Target Start/End: Complemental strand, 22574659 - 22574572
Alignment:
| Q |
24 |
cccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||||| ||| ||| || || ||| |||||||||| |||||||||| |
|
|
| T |
22574659 |
cccacaaaaccggcttgtgaggtgagaattgctctcacttataaacagattatcaagccatcacatatccgatgtgggactcttaaca |
22574572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 23 - 78
Target Start/End: Complemental strand, 31892442 - 31892387
Alignment:
| Q |
23 |
ccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| | ||||||||||| ||||||||| |
|
|
| T |
31892442 |
ccccacaaaaccggcttgtgaggtgaagattgtccccacttataaatacattgtca |
31892387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 1793979 - 1793921
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtc |
77 |
Q |
| |
|
|||||| |||||||| |||||||||||||||| || |||||||||| |||||||||||| |
|
|
| T |
1793979 |
acaaccgcacaaaactggcttgtgaggtgaggttttcctccacttacaaacacattgtc |
1793921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 111
Target Start/End: Original strand, 2404209 - 2404291
Alignment:
| Q |
29 |
aaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||| |||||| ||| ||||||||| |||||||||||||||||||||| | || || | ||||||||| |||||||||| |
|
|
| T |
2404209 |
aaaaccgacttgtggggttaggattgcccccacttataaacacattgtcagtccatctcctaaccgatgtgggactcttaaca |
2404291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 21 - 111
Target Start/End: Original strand, 6001462 - 6001552
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||| |||||| ||| || |||||||||||||||| ||||||||||||| ||||||||| || | | |||||||||| |||||||||| |
|
|
| T |
6001462 |
aaccctacaaaatcggtttctgaggtgaggattgcccccacttataaacatattgtcaggtcatcttctatccgatgtgggactcttaaca |
6001552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 40746557 - 40746495
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||| |||||||| ||||||||||||| ||||| || ||||||||||||| |||||||||| |
|
|
| T |
40746557 |
acaacctcacaaaactggcttgtgaggtgtggatttcccccacttataaacaaattgtcaggc |
40746495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 47849630 - 47849576
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| | |||||||||||||| |
|
|
| T |
47849630 |
acaagcccacaaaaccgggttgtgaggtgaggattgccccaacttataaacacat |
47849576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 23 - 104
Target Start/End: Original strand, 23796052 - 23796132
Alignment:
| Q |
23 |
ccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaact |
104 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||| |||||||||||| | ||||||| | || | |||||||||||||||| |
|
|
| T |
23796052 |
ccccataaaatcggcttgtgaggtgaggattgcc-ccacttataaacccgttgtcagaccatcttttgtccgatgtggaact |
23796132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 78
Target Start/End: Original strand, 35308173 - 35308230
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
||||| ||||||||| ||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
35308173 |
aaccctacaaaaccgaattgtgaggtgatgattgcccccacttataaacacattgtca |
35308230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 67
Target Start/End: Complemental strand, 1000608 - 1000560
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataa |
67 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||| |||||||||| |
|
|
| T |
1000608 |
acaaccccacaaaaccgtcttgtaaggtgaggattgcccccacttataa |
1000560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 23 - 111
Target Start/End: Original strand, 3519759 - 3519842
Alignment:
| Q |
23 |
ccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||| ||| || |||||||||||||||||||||||| || | | |||||||||| |||||||||| |
|
|
| T |
3519759 |
ccccacaaaaccggcttgtgagg-----attacccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca |
3519842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 4268103 - 4268051
Alignment:
| Q |
29 |
aaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||| |||||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
4268103 |
aaaaccggcttttgaggtgatgattgcccccacttataaacaaattgtcaggc |
4268051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 6782920 - 6782880
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6782920 |
acaaccccacaaaaccggcttgtaaggtgaggattgcctcc |
6782880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 111
Target Start/End: Complemental strand, 25620422 - 25620338
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||| |||||||||||| |||||||| | |||||||| |||||||||||| ||||| | || ||||| | |||||||||| |
|
|
| T |
25620422 |
acaaaacctgcttgtgaggtggggattgcccctacttataagcacattgtcaggtcatgtcctatctgatgtaggactcttaaca |
25620338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 21 - 113
Target Start/End: Complemental strand, 28080721 - 28080630
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
||||||||||||||| ||||||| |||| |||||| | ||||||||||||||||||||| || || | ||||||||| |||||||||||| |
|
|
| T |
28080721 |
aaccccacaaaaccgacttgtgaagtgaaaattgcc-ctacttataaacacattgtcaggtcatctcttatccgatgtgagactcttaacaat |
28080630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 71
Target Start/End: Original strand, 30727151 - 30727195
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30727151 |
acaaaaccagcttgtgaggtgaggattgcccccacttataaacac |
30727195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 31257292 - 31257352
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||| ||||||||||| | |||||||| |
|
|
| T |
31257292 |
acaaccccacaaaaccggcttgtgaattaaggattgcccccacttataaataaattgtcag |
31257352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 32292578 - 32292526
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
32292578 |
acaaccccacaaatccggcttgtgaggtgaggaccgcccccacttataaacac |
32292526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 40746058 - 40746150
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| ||||||||| ||| ||||||||||| ||||| | | ||||||||||||||||| || ||||| | |||||||||| |||||||||| |
|
|
| T |
40746058 |
acaatcccacaaaatcggtttgtgaggtgaagattgtcccttcttataaacacattgtctagccatgtcctatccgatgtgggactcttaaca |
40746150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 47849849 - 47849797
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||| | |||||||||||| |
|
|
| T |
47849849 |
acaaccccacaaaactggcttgtgaggtgagtattgccccaacttataaacac |
47849797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 112
Target Start/End: Original strand, 2404443 - 2404526
Alignment:
| Q |
29 |
aaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||| |||||| ||||||||||||| | |||||||||||||||||||| | | || | ||||| |||| ||||||||||| |
|
|
| T |
2404443 |
aaaaccgacttgtggggtgaggattgcccctacttataaacacattgtcagtccgtctcctatccgacgtgggactcttaacaa |
2404526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 4506991 - 4506932
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||| | || |||||||||||||||| |
|
|
| T |
4506991 |
acaaccccataaaaccgacttgtgaggtgaggattgctgcaacgtataaacacattgtca |
4506932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 74
Target Start/End: Original strand, 20305688 - 20305743
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacatt |
74 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20305688 |
acaaccccacaaaataagtttgtgaggtgaggattgcccccacttataaacacatt |
20305743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 24 - 63
Target Start/End: Complemental strand, 32474554 - 32474515
Alignment:
| Q |
24 |
cccacaaaaccggcttgtgaggtgaggattgcctccactt |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32474554 |
cccacaaaaccggcttgtgaggtgaggattgcccccactt |
32474515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 27 - 78
Target Start/End: Original strand, 40792830 - 40792881
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||| |||||||||||||||||| | || ||||||||||||||||||||| |
|
|
| T |
40792830 |
acaaaatcggcttgtgaggtgaggactaccgccacttataaacacattgtca |
40792881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 26 - 113
Target Start/End: Complemental strand, 41191066 - 41190979
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||| |||||||| || ||| || ||||||| |||||||||||| |
|
|
| T |
41191066 |
cacaaaaccggcttgtgatgtgaggattgctctcacttataaacatattgtcagattatcacatatctgatgtgggactcttaacaat |
41190979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 15317611 - 15317557
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||| ||||||||| | ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15317611 |
acaacaccacaaaactagtttgtgaggtgaggattgcccccacttataaacacat |
15317557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 40898740 - 40898794
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||| |||||||| ||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
40898740 |
acaactccacaaaatcggtttgtaaggtgaggattgcccccacttataaacacat |
40898794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 40898947 - 40899001
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||| |||| |||||| ||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
40898947 |
acaatcccataaaaccagcttgtgaggtgatgattgcccccacttataaacacat |
40899001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 14 - 71
Target Start/End: Original strand, 21473085 - 21473142
Alignment:
| Q |
14 |
catcaacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||| |||||||||||||| |
|
|
| T |
21473085 |
catcaacaacctcacaaaattggtttgtgaggtgaggattgctcccacttataaacac |
21473142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 23796209 - 23796266
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
|||||||||||||| | ||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
23796209 |
acaaccccacaaaatcaatttgtgaggtgatgattgcccccacttataaacacattgt |
23796266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 112
Target Start/End: Complemental strand, 5522925 - 5522845
Alignment:
| Q |
32 |
accggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| |||||||||||||| | | || | | |||||||| ||||||||||| |
|
|
| T |
5522925 |
accggcttgtgaggtgaagattgctcccacttaaaaacacattgtcagaccaactcttatacgatgtgggactcttaacaa |
5522845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 9688895 - 9688987
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| |||| |||||| || ||||||||||||||||| |||||| ||||| ||| |||||| | || | ||||||||||||||||||||| |
|
|
| T |
9688895 |
acaatcccataaaaccagcctgtgaggtgaggattgcatccactcataaatacagtgtcagaccatcatctatccgatgtggaactcttaaca |
9688987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 67
Target Start/End: Original strand, 14540977 - 14541025
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataa |
67 |
Q |
| |
|
||||||||||||||||| ||| ||||||| |||||||| |||||||||| |
|
|
| T |
14540977 |
acaaccccacaaaaccgacttatgaggtgtggattgcccccacttataa |
14541025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 27 - 79
Target Start/End: Original strand, 32279099 - 32279151
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||| ||||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
32279099 |
acaaaactggcttgttaggtgaggattgtccacacttataaacacattgtcag |
32279151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 36 - 79
Target Start/End: Complemental strand, 4267896 - 4267853
Alignment:
| Q |
36 |
gcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
4267896 |
gcttttgaggtgaggattgcccccacttataaacaaattgtcag |
4267853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 55
Target Start/End: Original strand, 30727381 - 30727416
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgc |
55 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30727381 |
caacctcacaaaaccggcttgtgaggtgaggattgc |
30727416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 27 - 82
Target Start/End: Complemental strand, 34124125 - 34124070
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggca |
82 |
Q |
| |
|
|||||||||||||| |||||| || |||| |||||||||||||| |||||||||| |
|
|
| T |
34124125 |
acaaaaccggcttgctaggtgaagactgcccccacttataaacacgttgtcaggca |
34124070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 2938026 - 2937972
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||| |||||| |||||||||||||||||| |||| |||||| ||||||||||| |
|
|
| T |
2938026 |
acaatcccacacaaccggcttgtgaggtgaatattgtctccacatataaacacat |
2937972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 70
Target Start/End: Original strand, 23794386 - 23794432
Alignment:
| Q |
24 |
cccacaaaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
23794386 |
cccacaaaattggcttgtgaggtgaggattgccaccatttataaaca |
23794432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 73
Target Start/End: Complemental strand, 24432128 - 24432083
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||||| ||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
24432128 |
acaaaaccgacttgtgaggtgaggactgcc-ccacttataaacacat |
24432083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 26028986 - 26029048
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||| ||| ||| ||| | |||||||||| |
|
|
| T |
26028986 |
acaacctcacaaaatcggcttgtgaggtgaggattgctcccatttaaaaataaattgtcaggc |
26029048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 33834477 - 33834435
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccac |
61 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
33834477 |
acaaacccacaaaaccggcttgtgaggtgaagattgcccccac |
33834435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 107
Target Start/End: Complemental strand, 38467015 - 38466950
Alignment:
| Q |
41 |
tgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
|||||||| ||||||||| ||||||||| |||||||| ||| || || |||||||||||| |||||| |
|
|
| T |
38467015 |
tgaggtgatgattgcctc-acttataaatacattgtcgggctatctcttgtccgatgtgggactctt |
38466950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 59
Target Start/End: Original strand, 6751522 - 6751555
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
6751522 |
cacaaaaccggcttgtgaggtgaggagtgcctcc |
6751555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 59
Target Start/End: Original strand, 6751726 - 6751759
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
6751726 |
cacaaaaccggcttgtgaggtgaggagtgcctcc |
6751759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 59
Target Start/End: Original strand, 6813300 - 6813333
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
6813300 |
cacaaaaccggcttgtgaggtgaggagtgcctcc |
6813333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 34 - 111
Target Start/End: Complemental strand, 22574879 - 22574803
Alignment:
| Q |
34 |
cggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||| | || ||| ||||||||| |||||||||| |
|
|
| T |
22574879 |
cggcttgtgaggtgaggattgccctcacttataaa-acattgtcatgtcatcacatatccgatgtgagactcttaaca |
22574803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 59
Target Start/End: Complemental strand, 29252663 - 29252630
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
29252663 |
cacaaaaccggcttgtaaggtgaggattgcctcc |
29252630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 2232182 - 2232150
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
2232182 |
acaaaatcggcttgtgaggtgaggattgcctcc |
2232150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 6783124 - 6783092
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
6783124 |
acaaaaccggcttgtaaggtgaggattgcctcc |
6783092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 108
Target Start/End: Complemental strand, 9625471 - 9625383
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctta |
108 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||| | ||||||||||| | |||||||| | || | | ||| |||||||||||||| |
|
|
| T |
9625471 |
caaccccgcaaaaccaccttgtgaggtgaggattatccccacttataaatatattgtcagaccatcacctatccaatgtggaactctta |
9625383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 25507456 - 25507508
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| |||| |||||| ||||||| |
|
|
| T |
25507456 |
acaaccccacaaaattggcttgtgaggcgaggactgcccccacttgtaaacac |
25507508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 31374851 - 31374819
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
31374851 |
acaaaaccggcttgtaaggtgaggattgcctcc |
31374819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 40703429 - 40703461
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
40703429 |
acaaaaccggcttgtgaggtgaggagtgcctcc |
40703461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 123)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 35796767 - 35796859
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
35796767 |
acaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcatgccatgtcctgtccgatgtggaactcttaaca |
35796859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 22845472 - 22845564
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||| || ||||||| |||||||||| |
|
|
| T |
22845472 |
acaaccccacaaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatgtcatatctgatgtgggactcttaaca |
22845564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 39902588 - 39902680
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| ||||| | |||||||||| |||||||||| |
|
|
| T |
39902588 |
acaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
39902680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 107
Target Start/End: Original strand, 27464273 - 27464361
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| || | |||||||||| |||||| |
|
|
| T |
27464273 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacactttgtcaggaaatctcttatccgatgtgggactctt |
27464361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 35788718 - 35788626
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| | || ||||||| |||||||||| |
|
|
| T |
35788718 |
acaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctatctgatgtgggactcttaaca |
35788626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 35788953 - 35788861
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |||| | |||||||||| |||||||||| |
|
|
| T |
35788953 |
acaaccccacaaaaccggcttgtgagatgaggattgcccccacttataaacacattgtcaggccatgttctatccgatgtgggactcttaaca |
35788861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 5398501 - 5398592
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||| ||| | |||||||||||| |||||||||| |
|
|
| T |
5398501 |
acaaccccacaaaaccggcttgtgaggtgaggattgcc-ccagttataaacacattgttaggccatgacttgtccgatgtgggactcttaaca |
5398592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 22231098 - 22231190
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| || || | |||||||| | |||||||||| |
|
|
| T |
22231098 |
acaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaacacattgtcaggccatatcctatccgatgtaggactcttaaca |
22231190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 22863533 - 22863441
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| || | ||||||||||| |||||||||| |
|
|
| T |
22863533 |
acaaccccacaaaaccggcttgtggggtgaggattgcccccacttataaacacattgtcaggccatcttctgtccgatgtgagactcttaaca |
22863441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 27634549 - 27634633
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||||||| ||||| | |||||||||| |||||||||| |
|
|
| T |
27634549 |
acaaaaccggcttgtgaggtgaggattgcccccactcataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
27634633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 28245551 - 28245643
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || | | ||||||||| |||||||||| |
|
|
| T |
28245551 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgagactcttaaca |
28245643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 109
Target Start/End: Complemental strand, 37836139 - 37836049
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaa |
109 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||| ||||||||||| ||||||| |||| ||||| |||||||||||| |||||||| |
|
|
| T |
37836139 |
acaaccccacaaaaccggcttgtaaggagaggattgcccccacttataaatacattgttaggccatgtcctgtccgatgtgggactcttaa |
37836049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 53814954 - 53815047
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||||||||||||||| |
|
|
| T |
53814954 |
acaaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtggaactcttaacaa |
53815047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 21498854 - 21498762
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
21498854 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
21498762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 107
Target Start/End: Complemental strand, 22827597 - 22827509
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||||||||| || || | |||||||||| |||||| |
|
|
| T |
22827597 |
acaacccgacaaaaccggcttgtgaggtgaggattgcccccacttataaacacgttgtcaggccatctcctatccgatgtgggactctt |
22827509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 27634114 - 27634198
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| ||| ||||||||||||||||||| |||||||||||||||||||||||| ||||| | |||||||||| |||||||||| |
|
|
| T |
27634114 |
acaaaatcggtttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
27634198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 107
Target Start/End: Original strand, 44118884 - 44118972
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||||||| || || | |||||||||| |||||| |
|
|
| T |
44118884 |
acaaccccacaaaacgggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatctcttatccgatgtgggactctt |
44118972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 50543592 - 50543684
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| || | | |||||||||| |||||||||| |
|
|
| T |
50543592 |
acaactccacaaaaccggcttgtgaggtgaggattgcccccacttatacacacattgtcaggccatcacctatccgatgtgggactcttaaca |
50543684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 99
Target Start/End: Complemental strand, 52559626 - 52559546
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| ||||||| ||| ||||| |
|
|
| T |
52559626 |
acaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcaggtcatgtcatatccaatgtg |
52559546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 28246110 - 28246169
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28246110 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtca |
28246169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 21 - 111
Target Start/End: Complemental strand, 21498411 - 21498321
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
21498411 |
aaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
21498321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 400590 - 400683
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| || |||||||||||||||||||||| | || |||| || |||||| ||||||||||| |
|
|
| T |
400590 |
acaacctcacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcagaccatctcatatctgatgtgagactcttaacaa |
400683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 6778694 - 6778779
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccactt-ataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||| |||||| ||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
6778694 |
acaaaaccggcttgtgaggtgaggattgtctcctctttataaactcattgtcaggccatgtcatatccgatgtgggactcttaaca |
6778779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 5398237 - 5398328
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| || ||||||||||||||||||| | ||| | ||||| |||||| |||||||||| |
|
|
| T |
5398237 |
acaaccccacaaaaccggcttgtgagatgaggattgcc-cctcttataaacacattgtcagaccatgacttgtccaatgtgggactcttaaca |
5398328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 9279286 - 9279194
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||| || | | ||||||||| |||||||||| |
|
|
| T |
9279286 |
acaaccccacaaaaccggctagtgaggtgatgattgcccccacttataaacacattgtcaggccatcacctatccgatgtgcgactcttaaca |
9279194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 11036771 - 11036863
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||| |||||||||||||||||||||||| || | | |||||||| | |||||||||| |
|
|
| T |
11036771 |
acaaccccacacaatcggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgttgtactcttaaca |
11036863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 21685057 - 21684965
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| ||||| | ||||||||| |||||||||| |
|
|
| T |
21685057 |
acaaccccacaaaatcggcttgtgaggtgaggatttatcccacttataaacacattgtcaggccatgtcctatccgatgtgagactcttaaca |
21684965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 22231333 - 22231425
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| | ||| ||||| || |||| |||||||| | |||||||||| |
|
|
| T |
22231333 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatatattctcaggtcatatcatatccgatgtaggactcttaaca |
22231425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 53828548 - 53828640
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| ||||||||||||| |||||||||| | || | |||||||||||||||||||| |
|
|
| T |
53828548 |
acaaccccacaaaatcggcttatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtggaactcttaaca |
53828640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 12869054 - 12869116
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
12869054 |
acaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaacaaattgtcaggc |
12869116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 1518223 - 1518162
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
1518223 |
acaaccccacaaaaccggcttgtgagctgaggattgcccccacttataaacaaattgtcagg |
1518162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 112
Target Start/End: Complemental strand, 25052911 - 25052818
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| || ||||||||||||| |||||||||| | || | ||||||||| ||||||||||| |
|
|
| T |
25052911 |
acaaccccacaaaaccggcttgtgaggtgcggattacccccacttataaacaaattgtcaggccaattcctaaccgatgtgggactcttaacaa |
25052818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 26 - 111
Target Start/End: Original strand, 31254439 - 31254524
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||| |||| |||||||||||||| |||||||||||||||||||||||| || | | |||||||||| |||||||||| |
|
|
| T |
31254439 |
cacaaaaccggtttgtaaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca |
31254524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 83
Target Start/End: Complemental strand, 2463865 - 2463801
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaa |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||| ||| |||||||||||| |
|
|
| T |
2463865 |
acaaccccacaaaaccggcttgtgaggtaaggattgcccccacttatacacaaattgtcaggcaa |
2463801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 20822032 - 20821940
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
20822032 |
acaatcccacaaaaccggcttgtgaggtgagaattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
20821940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 35797002 - 35797094
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| ||||||||||||| ||||||| | || || |||||||| ||| |||||||||| |
|
|
| T |
35797002 |
acaaccccacaaaactggtttgtgaggtgaggattgcccccacttataaacatattgtcatgtcatctcctgtccgatatgggactcttaaca |
35797094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 50543355 - 50543415
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
50543355 |
acaaccccacaaaaccggcttgtggggtgaggattgcccccacttatacacacattgtcag |
50543415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 20 - 79
Target Start/End: Complemental strand, 5846204 - 5846145
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
5846204 |
caaccccacaaaaccggcttatgaggtgaggattgcccccacttataaacaaattgtcag |
5846145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 21 - 100
Target Start/End: Complemental strand, 7892605 - 7892526
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtgg |
100 |
Q |
| |
|
|||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||| | || |||||||| |||||| |
|
|
| T |
7892605 |
aaccccacaaaaccggattgtgagatgaaaattgcctccacttataaacacattgtcagaccatatcatgtccaatgtgg |
7892526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 109
Target Start/End: Complemental strand, 35175094 - 35175004
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaa |
109 |
Q |
| |
|
||||||| |||||| || |||||||||||| |||| || || ||||||||||||||||||||| |||| |||||||||||| |||||||| |
|
|
| T |
35175094 |
acaaccctacaaaatcgacttgtgaggtgatgattaccccctcttataaacacattgtcaggccatgttctgtccgatgtgggactcttaa |
35175004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 9685691 - 9685634
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
9685691 |
acaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgt |
9685634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 34358055 - 34358116
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
34358055 |
acaaccccacaaaaccggcttctgatgtgaggattgcccccatttataaacacattgtcagg |
34358116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 27 - 111
Target Start/End: Complemental strand, 5846430 - 5846346
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||| || | || | ||||||||| |||||||||| |
|
|
| T |
5846430 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcatgccaactcctaaccgatgtgggactcttaaca |
5846346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 23 - 107
Target Start/End: Complemental strand, 7926383 - 7926299
Alignment:
| Q |
23 |
ccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||| |||||||||||||||| |||||| || | ||||||||||||||||||| |
|
|
| T |
7926383 |
ccccacaaaaccggcttgtgttgtgaggaatgcccccacttataaacacatgttcaggccatcttttgtccgatgtggaactctt |
7926299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 35609515 - 35609567
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
35609515 |
acaaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaacac |
35609567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 35609736 - 35609788
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
35609736 |
acaaccccacaaaaccggcttgtgaggtgaggattggccccacttataaacac |
35609788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 35645790 - 35645850
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||| | ||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35645790 |
acaaccctaaaaaactggcttgtgaggtgaggattgcccccacttataaacacattgtcag |
35645850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 53828314 - 53828406
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| ||| || |||||||||||||||| ||||||||||||| |||||||||| | || | ||||||||| |||||||||| |
|
|
| T |
53828314 |
acaaccccacaaaatcggtttatgaggtgaggattgcccccacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
53828406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 26 - 81
Target Start/End: Original strand, 7806613 - 7806668
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
7806613 |
cacaaaaccggcttgtgaggtgaggattgccgccacttaaaaatacattgtcaggc |
7806668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 11036536 - 11036595
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
11036536 |
acaaccccgcaaaaccggcttgtgaggtgatgattgccccaacttataaacacattgtca |
11036595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 114
Target Start/End: Original strand, 35819153 - 35819248
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaatg |
114 |
Q |
| |
|
|||||| |||||||| ||||||||||| |||||||||| |||| |||||||| |||||||||| | || | ||||||||| ||||||||||||| |
|
|
| T |
35819153 |
acaacctcacaaaactggcttgtgaggcgaggattgcccccacatataaacaaattgtcaggccaactcctaaccgatgtgggactcttaacaatg |
35819248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 27 - 113
Target Start/End: Original strand, 13555500 - 13555586
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||| |||||||||| | || | | |||||||||| |||||||||||| |
|
|
| T |
13555500 |
acaaaaccggcttgtgaggtgaggatttcccccacttataagcacattgtcaaaccatcacctatccgatgtgggactcttaacaat |
13555586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 40717466 - 40717528
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||| ||||||||||||| ||| |||||| |
|
|
| T |
40717466 |
acaaccccacaaaaccgacttttgaggtgaggattgcccccacttataaacaaattatcaggc |
40717528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 53814699 - 53814761
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
53814699 |
acaatcccacaaaaccggcttgtgaggtgaggattatccccacttataaacaaattgtcaggc |
53814761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 27 - 100
Target Start/End: Complemental strand, 52559855 - 52559782
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtgg |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||||| | ||||| | |||||||||| |
|
|
| T |
52559855 |
acaaaaccggcttgtgaggtgagaattgctcccacttataaacacattgtcaagtcatgtcctatccgatgtgg |
52559782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 73
Target Start/End: Complemental strand, 8902684 - 8902632
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
8902684 |
aaccccacaaaactggcttgtgaggagaggattgcctccactaataaacacat |
8902632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 107
Target Start/End: Original strand, 12005494 - 12005582
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||| |||| || ||| || || | |||||||||||| |||||| |
|
|
| T |
12005494 |
acaacctcacaaaaccggcttgtgaggtgaggattgcccccacttattaacaaatgttcatgccatattttgtccgatgtgggactctt |
12005582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 14783212 - 14783272
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| || ||||||||| |||||||| |
|
|
| T |
14783212 |
acaaccccacaaaaccggcttgtgaggtgatgattgcccacagttataaacaaattgtcag |
14783272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 75
Target Start/End: Original strand, 28073206 - 28073262
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattg |
75 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||| |||| |||||| |
|
|
| T |
28073206 |
acaaccccacaaaaccagcttgtgaggtgagggttgcctccacttgtaaatacattg |
28073262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 29 - 76
Target Start/End: Complemental strand, 6218488 - 6218441
Alignment:
| Q |
29 |
aaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
6218488 |
aaaaccggcttgtgaggtgatgattgcccccacttataaacacattgt |
6218441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 20 - 79
Target Start/End: Original strand, 41187958 - 41188017
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
41187958 |
caaccccacaaaaccaacttgtgaggtgaggattgcctttacttataaatacattgtcag |
41188017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 27 - 73
Target Start/End: Original strand, 2221001 - 2221047
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
2221001 |
acaaaaccggcttgtgaggtgaggattgcccccacctataaacacat |
2221047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 9685457 - 9685395
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||| | ||||||||||||| ||||| |||| |
|
|
| T |
9685457 |
acaacctcacaaaaccgacttgtgaggtgaggattggccccacttataaacaaattgttaggc |
9685395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 16066116 - 16066062
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||| | ||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
16066116 |
acaaaaccagtttgtgaggtgaggattgcccccacttataaacaaattgtcaggc |
16066062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 27 - 69
Target Start/End: Original strand, 17222685 - 17222727
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaac |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17222685 |
acaaaaccggcttgtgaggtgaggattgcccccacttataaac |
17222727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 6218263 - 6218206
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
||||| ||||||||||| |||||||||||| ||||||| ||||||||||||| ||||| |
|
|
| T |
6218263 |
acaactccacaaaaccgtcttgtgaggtgaagattgcccccacttataaacatattgt |
6218206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 78
Target Start/End: Original strand, 21750069 - 21750126
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||| | ||||||| |
|
|
| T |
21750069 |
aaccccacaaaaccggcttgtgaggtgaggaatgctcccacttataaagatattgtca |
21750126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 72
Target Start/End: Complemental strand, 22822409 - 22822356
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacaca |
72 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| || ||||||||||||||| |
|
|
| T |
22822409 |
acaaccgcacaaaaccggcttgtgtggtgaggatttcccccacttataaacaca |
22822356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 36685900 - 36685961
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| || ||| ||||||||||||||||||| |
|
|
| T |
36685900 |
acaaccccacaaaactgacttgtgaggtgaggataacccccatttataaacacattgtcagg |
36685961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 52146090 - 52146127
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcc |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52146090 |
acaaccccacaaaaccggcttgtgaggtgaggattgcc |
52146127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 54054830 - 54054887
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
|||||||||||||| |||||| ||||||||| |||||| ||||||||||||| ||||| |
|
|
| T |
54054830 |
acaaccccacaaaaacggcttatgaggtgagaattgcccccacttataaacaaattgt |
54054887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 6666225 - 6666277
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||| ||| |||||||||| |
|
|
| T |
6666225 |
acaaccccacaaaacctgtttgtgaggtgaggattgcccccaattataaacac |
6666277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 75
Target Start/End: Original strand, 18528242 - 18528298
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattg |
75 |
Q |
| |
|
||||||| |||||| || ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18528242 |
acaaccctacaaaatcgatttgtgaggtgaggattgccgccacttataaacacattg |
18528298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 25323823 - 25323875
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||| |||| ||||||||| |
|
|
| T |
25323823 |
acaaccccacaaaaccggcctgcgaggtgaggattgcccccacgtataaacac |
25323875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 111
Target Start/End: Original strand, 40717255 - 40717323
Alignment:
| Q |
43 |
aggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||| |||| |||| ||||||| |||||||||| |
|
|
| T |
40717255 |
aggtgaggattgtccccacttataaacacattgtcaggtcatgttctgtctgatgtgggactcttaaca |
40717323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 12869288 - 12869347
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| | ||||||||||| | ||||||| |
|
|
| T |
12869288 |
acaaccccacaaaaccgtcttatgaggtgaggattgtccccacttataaataaattgtca |
12869347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 71
Target Start/End: Original strand, 42684819 - 42684870
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||| ||| |||||||||| |
|
|
| T |
42684819 |
caacgccacaaaaccggcttgtgaggtgatgattgcccccatttataaacac |
42684870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 2261778 - 2261840
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||| || |||||||||||||||| | ||||||||||| | |||||||||| |
|
|
| T |
2261778 |
acaaccccacaaaactggtctgtgaggtgaggattgtccccacttataaataaattgtcaggc |
2261840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 35485286 - 35485232
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||||||||||||| || ||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
35485286 |
acaaccccacaaaaccagcgtgtaaggtgaggactgcccccacttataaacacat |
35485232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 99
Target Start/End: Complemental strand, 26549696 - 26549615
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgc-ctccacttataaacacattgtcaggcaatgtcatgtccgatgtg |
99 |
Q |
| |
|
||||| |||||||||||||||||||| | |||||| | | |||||||||||||||| ||||||| || || | ||||||||| |
|
|
| T |
26549696 |
acaacaccacaaaaccggcttgtgagataaggattactccccacttataaacacatcgtcaggccatctcttatccgatgtg |
26549615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 36 - 80
Target Start/End: Original strand, 980092 - 980136
Alignment:
| Q |
36 |
gcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
980092 |
gcttgtgaggtgaggattgcccccacttataaacaaattctcagg |
980136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 107
Target Start/End: Complemental strand, 7926617 - 7926529
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||||| ||||||| |||||||| |||||| || | |||||||||||| |||||| |
|
|
| T |
7926617 |
acaaccccacaaaatcggcacgtagggtgaggattgcccccacttacaaacacatgttcaggccatcttttgtccgatgtgggactctt |
7926529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 13555272 - 13555364
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| |||| |||||| || ||||||||||||||||| |||||| ||||| ||| |||||| | || | ||||||||||||||||||||| |
|
|
| T |
13555272 |
acaatcccataaaaccagcctgtgaggtgaggattgcatccactcataaatacagtgtcagaccatcatctatccgatgtggaactcttaaca |
13555364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 22 - 70
Target Start/End: Original strand, 20726631 - 20726679
Alignment:
| Q |
22 |
accccacaaaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
|||||||||||| |||||||| ||||| ||||||| ||||||||||||| |
|
|
| T |
20726631 |
accccacaaaactggcttgtgtggtgatgattgcccccacttataaaca |
20726679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 22867178 - 22867138
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
22867178 |
acaaccccacaaaaccggcttgtaaggtgaggagtgcctcc |
22867138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 66
Target Start/End: Original strand, 24513395 - 24513431
Alignment:
| Q |
30 |
aaaccggcttgtgaggtgaggattgcctccacttata |
66 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24513395 |
aaaccggcttgtgaggtgaggattgcccccacttata |
24513431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 25324058 - 25324110
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
|||||||||||||| || |||||||||||| |||||| |||||||||||||| |
|
|
| T |
25324058 |
acaaccccacaaaatcgacttgtgaggtgataattgcccccacttataaacac |
25324110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 48052817 - 48052869
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||| |||||| ||||||| |
|
|
| T |
48052817 |
acaaccccacaaaaccagcttgtgaggtgaggactgctcccacttgtaaacac |
48052869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 50859066 - 50859015
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
50859066 |
acaaccccacaaa-ccggcttgtgaggtgaggatttcacccacttataaacac |
50859015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 63
Target Start/End: Original strand, 53559315 - 53559359
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccactt |
63 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
53559315 |
acaaccccacaaaatcggcttgtaaggtgaggattgcccccactt |
53559359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 53699086 - 53699026
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||| ||| ||| ||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
53699086 |
acaaccccataaagtcggtttgtgaggtgaggattgcccacacttataaacatattgtcag |
53699026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 81
Target Start/End: Original strand, 54055064 - 54055119
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||||||||||||| ||||| |||| |
|
|
| T |
54055064 |
ccacaaaac-ggcttgtgagatgaggattgcccccacttataaacaaattgttaggc |
54055119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 71
Target Start/End: Original strand, 7572728 - 7572779
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
|||||||||||| | |||||||||||||| |||| || |||||||||||||| |
|
|
| T |
7572728 |
caaccccacaaagctggcttgtgaggtgaagattacccccacttataaacac |
7572779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 70
Target Start/End: Original strand, 13495491 - 13495542
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaaca |
70 |
Q |
| |
|
||||||| |||||| | |||||||||||||||||| |||||||||||||||| |
|
|
| T |
13495491 |
caacccctcaaaactgacttgtgaggtgaggattgtcctccacttataaaca |
13495542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 13637448 - 13637389
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||||||||||| |||||| |||| ||||||| | ||||||||||||||||||| |
|
|
| T |
13637448 |
acaaccccacaaaaccaaattgtgaagtgaagattgcccctacttataaacacattgtca |
13637389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 73
Target Start/End: Original strand, 21646297 - 21646344
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||||| ||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
21646297 |
cacaaaactggcttgtaaggtgaggattgcccccatttataaacacat |
21646344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 55
Target Start/End: Original strand, 25324267 - 25324302
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgc |
55 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25324267 |
caaccccacaaaaccggcttgtgaggcgaggattgc |
25324302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 73
Target Start/End: Complemental strand, 33107921 - 33107875
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||| ||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
33107921 |
acaaaacttgcttgtgaggtgaagattgtctccacttataaacacat |
33107875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 65
Target Start/End: Complemental strand, 40726772 - 40726734
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttat |
65 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
40726772 |
acaaaaccggcttgtgaggtgaggatttcccccacttat |
40726734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 65
Target Start/End: Complemental strand, 41853433 - 41853387
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttat |
65 |
Q |
| |
|
|||||| |||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
41853433 |
acaacctcacaaaactagcttgtgaggtgaagattgcctccacttat |
41853387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 2516258 - 2516199
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||||||||||||||||| || |||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
2516258 |
acaaccccacaaaaccggctagt-aggtga-gattgctcccacttataaacatattgtcagg |
2516199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 63
Target Start/End: Original strand, 6666659 - 6666704
Alignment:
| Q |
18 |
aacaaccccacaaaaccggcttgtgaggtgaggattgcctccactt |
63 |
Q |
| |
|
||||| ||||||||||||| ||||||||| ||||||||| |||||| |
|
|
| T |
6666659 |
aacaatcccacaaaaccggtttgtgaggtaaggattgcccccactt |
6666704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 11783817 - 11783874
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| || | ||||||||||| ||||| |
|
|
| T |
11783817 |
acaaccccacaaaaccaatttgtgaggtgaggattacccctacttataaacaaattgt |
11783874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 99
Target Start/End: Original strand, 18528489 - 18528562
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtg |
99 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||| || | |||||||||||| | || || ||||||||||| |
|
|
| T |
18528489 |
cacaaaaccgatttgtgaggtgaggattgcccccaattgttaacacattgtcacactatctcctgtccgatgtg |
18528562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 28 - 73
Target Start/End: Complemental strand, 21041401 - 21041356
Alignment:
| Q |
28 |
caaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||||| |||||||||||||||| | |||||||||||||||| |
|
|
| T |
21041401 |
caaaaccggtttgtgaggtgaggattttccccacttataaacacat |
21041356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 27 - 80
Target Start/End: Original strand, 30566067 - 30566120
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||| ||||| ||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
30566067 |
acaaaactggcttatgatgtgagaattgctcccacttataaacacattgtcagg |
30566120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 34 - 111
Target Start/End: Original strand, 45784918 - 45784995
Alignment:
| Q |
34 |
cggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||| | ||||| | || | | |||||||||| |||||||||| |
|
|
| T |
45784918 |
cggcttgtgaggtgatgattgccgccacttataaacatactgtcaagtcatcacctatccgatgtgggactcttaaca |
45784995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 59
Target Start/End: Complemental strand, 49380747 - 49380714
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
49380747 |
cacaaaaccggcttgtaaggtgaggattgcctcc |
49380714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 59
Target Start/End: Original strand, 49380897 - 49380930
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
49380897 |
cacaaaaccggcttgtaaggtgaggattgcctcc |
49380930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 5488453 - 5488421
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
5488453 |
acaaaaccggcttgtaaggtgaggattgcctcc |
5488421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 12016701 - 12016733
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
12016701 |
acaaaaccggcttgtaaggtgaggattgcctcc |
12016733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 12016909 - 12016941
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
12016909 |
acaaaaccggcttgtaaggtgaggattgcctcc |
12016941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 108
Target Start/End: Original strand, 13611775 - 13611863
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctta |
108 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||| | ||||||||||| | |||||||| | || | | ||| |||||||||||||| |
|
|
| T |
13611775 |
caaccccgcaaaaccaccttgtgaggtgaggattatccccacttataaatatattgtcagaccatcacctatccaatgtggaactctta |
13611863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 19125778 - 19125718
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||| |||||||||||||| | |||||| |||| | |||| ||||||||||||| |||| |
|
|
| T |
19125778 |
acaacctcacaaaaccggcttttaaggtgatgattacatccatttataaacacattttcag |
19125718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 21646530 - 21646586
Alignment:
| Q |
23 |
ccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||| ||||||| ||||| |||||||||||| | | |||| ||||||||||||||| |
|
|
| T |
21646530 |
ccccataaaaccgacttgtaaggtgaggattgtccctacttgtaaacacattgtcag |
21646586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 74
Target Start/End: Complemental strand, 22445511 - 22445455
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacatt |
74 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||| || ||||| ||||||||||| |
|
|
| T |
22445511 |
acaaccccacaaaaccgacttgtagggtgaggattgccccccactaataaacacatt |
22445455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 23210109 - 23210069
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttata |
66 |
Q |
| |
|
|||||||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
23210109 |
cacaaaaccggcttgtgaggtgagaattacccccacttata |
23210069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 25753623 - 25753655
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
25753623 |
acaaaaccggcttgtaaggtgaggattgcctcc |
25753655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 28395263 - 28395231
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
28395263 |
acaaaaccggcttgtaaggtgaggattgcctcc |
28395231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 73
Target Start/End: Original strand, 30529961 - 30530005
Alignment:
| Q |
29 |
aaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||||||||||||||||| ||| || | |||||||||||||| |
|
|
| T |
30529961 |
aaaaccggcttgtgaggtgagaattaccccaacttataaacacat |
30530005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 31964876 - 31964927
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
31964876 |
acaaccctacaaaactggcttgtgaggtgaggactgcc-ccacatataaacac |
31964927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 40716646 - 40716686
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||| ||||||||| |||| |||||||||||| |
|
|
| T |
40716646 |
acaaccccacaaatccggcttgtaaggtaaggattgcctcc |
40716686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 43943759 - 43943727
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
43943759 |
acaaaaccggcttgtaaggtgaggattgcctcc |
43943727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 2e-29; HSPs: 109)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 17452853 - 17452946
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||| |||||||||||| ||||| | |||||||||| ||||||||||| |
|
|
| T |
17452853 |
acaaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaatacattgtcaggccatgtcttatccgatgtgggactcttaacaa |
17452946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 4113031 - 4113123
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |||||||||| ||| |||||| |
|
|
| T |
4113031 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcccatccgatgtgggacttttaaca |
4113123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 26865383 - 26865477
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||||||||| ||||| |||||||||||| || ||||||||| |
|
|
| T |
26865383 |
acaaccccacaaaaccggcttgtgaggtggggattgcccccacttataaatacattgtcaggtcatgtcttgtccgatgtgggacacttaacaat |
26865477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 26176967 - 26176875
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| ||||||||| ||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
26176967 |
acaaccccacaaaaccggtttttgaggtgaggattgccctcacttataagcacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
26176875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 35772323 - 35772231
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||| |||||||||||||||||||||||| || || | |||||||||| |||||||||| |
|
|
| T |
35772323 |
acaaccccacaaaaccggcttctgaggtaaggattgcccccacttataaacacattgtcaggccatctcctatccgatgtgggactcttaaca |
35772231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 15986358 - 15986451
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||| |||||||||||||||||||||||| || || | |||||||| | ||||||||||| |
|
|
| T |
15986358 |
acaaccccacaataccagcttgtgaggtgaggattgcccccacttataaacacattgtcaggctatctcctatccgatgtaggactcttaacaa |
15986451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 17452704 - 17452785
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| ||||| | || ||||||| |
|
|
| T |
17452704 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcttatctgatgtgg |
17452785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 40079211 - 40079150
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40079211 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagg |
40079150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 52650796 - 52650889
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| ||| || || | |||||||||| |||| |||||| |
|
|
| T |
52650796 |
acaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacattgtccggccatctcctatccgatgtgggactcctaacaa |
52650889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 26177202 - 26177110
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||| || || |||||||||||||||| |||||||||||||| |||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
26177202 |
acaaccccacaaaactggtttttgaggtgaggattgcccccacttataaacacgttgtcaggtcatgtcctgtccgatgtgggactcttaaca |
26177110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 26 - 111
Target Start/End: Complemental strand, 856033 - 855948
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||| ||||||||||||||||||| | |||| ||||||||||||||||||| ||||| | |||| |||||||||||||||| |
|
|
| T |
856033 |
cacaaaaccagcttgtgaggtgaggattgtccccacgtataaacacattgtcaggccatgtcctatccggtgtggaactcttaaca |
855948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 41035852 - 41035945
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||| ||||| | ||||| ||| ||||||||||| |
|
|
| T |
41035852 |
acaatcccacaaaaccggcttgtgaggtgaggattgcccccacttataaacatattggcaggccatgtcctatccgacgtgagactcttaacaa |
41035945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 4112565 - 4112657
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| |||| |||| ||||||||||||||| ||||||| | ||||||||||||||||||| || ||||| |||||||||||| |||||||||| |
|
|
| T |
4112565 |
acaatcccataaaatcggcttgtgaggtgatgattgcccctacttataaacacattgtcatgccatgtcctgtccgatgtgggactcttaaca |
4112657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 38080663 - 38080572
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||| || || |||||||||| |||||||||| |
|
|
| T |
38080663 |
acaaccccacaaaactggcttgtgaggtgaggattgcc-ccaattataaacacattgtcaggccatctcccatccgatgtgggactcttaaca |
38080572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 107
Target Start/End: Original strand, 39348144 - 39348232
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
||||||||||| |||||||| || || |||||||||||||||||||||||||||||||||||| || || | |||||||||| |||||| |
|
|
| T |
39348144 |
acaaccccacagaaccggctggtaagttgaggattgcctccacttataaacacattgtcaggctatctcctatccgatgtgggactctt |
39348232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 51589051 - 51588957
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| | | || | ||||||||| |||||||||||| |
|
|
| T |
51589051 |
acaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaacaat |
51588957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 108
Target Start/End: Original strand, 2859417 - 2859506
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctta |
108 |
Q |
| |
|
|||||| |||| |||||||||||||||| ||||||||| |||||||||||||||||||||||| || | | |||||||||| ||||||| |
|
|
| T |
2859417 |
acaacctcacagaaccggcttgtgaggtaaggattgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactctta |
2859506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 3169825 - 3169765
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||| |
|
|
| T |
3169825 |
acaaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaacaaattgtcag |
3169765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 27 - 111
Target Start/End: Complemental strand, 7307772 - 7307688
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||| ||| || | ||||||||||| | |||||||||| |
|
|
| T |
7307772 |
acaaaaccgacttgtgaggtgagaattgcctccacttataaacacattgttaggtcatcttatgtccgatgttggactcttaaca |
7307688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 75
Target Start/End: Original strand, 12244987 - 12245043
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattg |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
12244987 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattg |
12245043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 20208553 - 20208643
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||| |||||||||||||||||||||| | ||||| | |||||||||| |||||||||| |
|
|
| T |
20208553 |
acaaccccacaaa-ccggcta-tgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctatccgatgtgggactcttaaca |
20208643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 25713452 - 25713360
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||| ||||||||| |||||||||||||| ||||||| |||||||||||||||||||||| | || | | |||||||||| |||||||||| |
|
|
| T |
25713452 |
acaactccacaaaactggcttgtgaggtgacgattgcccccacttataaacacattgtcagaccatcacctatccgatgtgggactcttaaca |
25713360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 26173481 - 26173573
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||| |||||||||||||||||||||| | || |||| || ||||||| |||||||||| |
|
|
| T |
26173481 |
acaaccccacaaaaccggcttacaaggtgagaattgcccccacttataaacacattgtcagaccatctcatatctgatgtgggactcttaaca |
26173573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 26346993 - 26347053
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
26346993 |
acaaccccacaaaacgggcttgtgaggtgaggattgtctccacttataaacacatcgtcag |
26347053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 30369894 - 30369802
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| | ||||||||||| |||||| | | || |||| ||||||||||||||||||||| |
|
|
| T |
30369894 |
acaaccccacaaaactatcttgtgaggtgaggattgcccctacttataaacatattgtcggaccatctcatatccgatgtggaactcttaaca |
30369802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 107
Target Start/End: Original strand, 31181538 - 31181626
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||| |||||||||||||||| |||||| || || | ||| ||||||||||||| |
|
|
| T |
31181538 |
acaaccccataaaaccagcttgtgaggtgaggattgcccccacttataaacacatgttcaggccatctcttatccaatgtggaactctt |
31181626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 42586464 - 42586555
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||| |||||||||||||| || || | ||||||||| |||||||||| |
|
|
| T |
42586464 |
acaaccccacaaaattggcttgtgaggtgaggattgcc-ccacttatatacacattgtcaggccatctcttatccgatgtgagactcttaaca |
42586555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 51589285 - 51589225
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
51589285 |
acaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcag |
51589225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 52961641 - 52961549
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||| | || || | |||||||||| || ||||||| |
|
|
| T |
52961641 |
acaaccccataaaaccggcttttgaggtgaggattgccctcacttataaacacattgtcagaccatctcctatccgatgtgggacacttaaca |
52961549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 24 - 79
Target Start/End: Original strand, 26173254 - 26173309
Alignment:
| Q |
24 |
cccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
26173254 |
cccacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcag |
26173309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 39348377 - 39348436
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
39348377 |
acaaccccacaaaaccggtttgtgaggtgaggattgcccccacttataaacacgttgtca |
39348436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 8870935 - 8871033
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag-----gcaatgtcatgtccgatgtggaactcttaacaa |
112 |
Q |
| |
|
|||||||||||||| |||||| ||||||||| |||||| | |||||||||||||||||||| | |||||||||||||||||| ||||||||||| |
|
|
| T |
8870935 |
acaaccccacaaaaacggcttatgaggtgagaattgccccaacttataaacacattgtcagatcatgtcatgtcatgtccgatgtgggactcttaacaa |
8871033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 21 - 111
Target Start/End: Complemental strand, 16163224 - 16163134
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| ||||||||||||||||||||| | || | | |||||||||| |||||||||| |
|
|
| T |
16163224 |
aaccccacaaaaccggattgtgaggtgaagattgcccccacttataaacacattgtcaagtcatcacctatccgatgtgggactcttaaca |
16163134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 21 - 111
Target Start/End: Complemental strand, 35892348 - 35892258
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||| ||||||||||| |||||||||| | || | || || ||||||| |||||||||| |
|
|
| T |
35892348 |
aaccccacaaaaccgggttgtgaggtgagtattgcccccacttataaatacattgtcagaccatcttatatctgatgtgggactcttaaca |
35892258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 52907443 - 52907389
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52907443 |
acaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacat |
52907389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 25145745 - 25145806
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
25145745 |
acaaccccacaaatccggcttgtgaggtgaggattgcccccactaataaatacattgtcagg |
25145806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 28408066 - 28408127
Alignment:
| Q |
18 |
aacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| | ||||||||||||| |||||||| |
|
|
| T |
28408066 |
aacaaccccacaaaaccggcttgtgaggtaaggattgtccccacttataaacaaattgtcag |
28408127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 2859652 - 2859712
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| || ||||| |||||||||||||||| |
|
|
| T |
2859652 |
acaacctcacaaaaccggcttgtgaggtgaggattacccccactaataaacacattgtcag |
2859712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 25145510 - 25145570
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
25145510 |
acaacctcacaaaaccgacttgtgaggtgaggattgcccccactaataaacacattgtcag |
25145570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 38668419 - 38668327
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| |||||||||||| ||||| |||||| ||||||| ||||||||||||||||||||| | || ||| |||||||||| |||||||||| |
|
|
| T |
38668419 |
acaatcccacaaaaccgacttgtaaggtgatgattgcccccacttataaacacattgtcaaaccatcacatatccgatgtgggactcttaaca |
38668327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 38733441 - 38733349
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| |||||||||||| | |||||||||||||||| |||||||||||| |||||||| | || ||| |||||||||| |||||||||| |
|
|
| T |
38733441 |
acaacctcacaaaaccggcctatgaggtgaggattgccctcacttataaacatattgtcagaccatcacatatccgatgtgggactcttaaca |
38733349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 43409865 - 43409774
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||| ||||||||||| |||||||||| | |||| | ||||||||| |||||||||| |
|
|
| T |
43409865 |
acaaccccccaaaaccggcttgtgaggtgagaattgcc-ccacttataaatacattgtcagaccatgttctatccgatgtgagactcttaaca |
43409774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 51589865 - 51589805
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
51589865 |
acaaccccacaaaatcggcttgtgaggtgaggattgccctcacttataaacaaattgtcag |
51589805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 29 - 111
Target Start/End: Original strand, 4112805 - 4112888
Alignment:
| Q |
29 |
aaaaccggcttgtgaggtgaggattgcctcc-acttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||| |||||||||||||||| || || |||||||||||||||||||||| ||||| |||||||||| |||||||||| |
|
|
| T |
4112805 |
aaaaccggtttgtgaggtgaggatttccccccacttataaacacattgtcaggccatgtcccatccgatgtgggactcttaaca |
4112888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 25137328 - 25137419
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaac |
110 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||| | || | ||||||||| ||||||||| |
|
|
| T |
25137328 |
acaaccccacaaaaccggcttatgaggtgaggattgcccatacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaac |
25137419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 27413641 - 27413579
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||| || ||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27413641 |
acaacctcataaaaccgatttgtgaggtgaggattgcctccacttataaacatattgtcaggc |
27413579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 42351885 - 42351939
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42351885 |
acaacaccacaaaactggcttgtgaggtgaggatggcctccacttataaacacat |
42351939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 20 - 73
Target Start/End: Original strand, 31004463 - 31004516
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31004463 |
caacccaacaaaaccagcttgtgaggtgaggattgcccccacttataaacacat |
31004516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 27 - 110
Target Start/End: Complemental strand, 369686 - 369603
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaac |
110 |
Q |
| |
|
|||||||| ||||| |||||||||||||| ||||||||||||||||| |||| | || || || ||||||||| ||||||||| |
|
|
| T |
369686 |
acaaaaccatcttgtaaggtgaggattgcccccacttataaacacattttcagactatctcctgcccgatgtgggactcttaac |
369603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 38668184 - 38668125
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||||||||| |||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
38668184 |
acaaccccacaaaattggcttgtgagatgatgattgcccccacttataaacacattgtca |
38668125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 31 - 73
Target Start/End: Original strand, 10991810 - 10991852
Alignment:
| Q |
31 |
aaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10991810 |
aaccggcttgtgaggtgaggattgccttcacttataaacacat |
10991852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 109
Target Start/End: Complemental strand, 16162992 - 16162902
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaa |
109 |
Q |
| |
|
|||||||||||||| ||| || |||||||||| ||| | ||||||| |||||||||||||||| || ||| ||||||||| |||||||| |
|
|
| T |
16162992 |
acaaccccacaaaatcggtttatgaggtgaggtttgtccccacttaaaaacacattgtcaggccatcacatatccgatgtgagactcttaa |
16162902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 16173263 - 16173210
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
16173263 |
acaacccca-aaaaccggctagtgaggtgaggattgcctccgcttataaacacat |
16173210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 40316075 - 40316129
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||| | |||||||||||||||| |
|
|
| T |
40316075 |
acaacctcacaaaaccggcttatgaggtgaggattgaccccacttataaacacat |
40316129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 3170060 - 3170011
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaa |
68 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
3170060 |
acaaccccacaaaaccggcttgtgaggtaaggattgccctcacttataaa |
3170011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 111
Target Start/End: Original strand, 4098195 - 4098280
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||| |||||| | |||||||||| |||||||||||||||| ||||| | || |||| | ||||||| |||||||||| |
|
|
| T |
4098195 |
cacaaaaccggtttgtgaagagaggattgcccccacttataaacacatcgtcagacgatctcatattcgatgtgagactcttaaca |
4098280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 30 - 71
Target Start/End: Original strand, 7465681 - 7465722
Alignment:
| Q |
30 |
aaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7465681 |
aaaccggcttgtgaggtgaggattgcccccacttataaacac |
7465722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 37 - 78
Target Start/End: Original strand, 8870732 - 8870773
Alignment:
| Q |
37 |
cttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8870732 |
cttgtgaggtgaggattgcccccacttataaacacattgtca |
8870773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 81
Target Start/End: Complemental strand, 17402768 - 17402711
Alignment:
| Q |
24 |
cccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||| |||||||| || |||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
17402768 |
cccaaaaaaccggattttgaggtgaggattgcccccacttataaacaaattgtcaggc |
17402711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 107
Target Start/End: Original strand, 21626363 - 21626452
Alignment:
| Q |
18 |
aacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
|||| |||||||||||||| || ||| |||||||| ||| ||||||||||||| |||||||||| || || | || ||||||| |||||| |
|
|
| T |
21626363 |
aacagccccacaaaaccggattttgaagtgaggatggcccccacttataaacatattgtcaggccatctcttatctgatgtgggactctt |
21626452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 27413406 - 27413345
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||| ||||| ||||| |||||||| |||| |
|
|
| T |
27413406 |
acaacctcacaaaatcggcttgtgaggtgaggattgtctccagttatacacacattgccagg |
27413345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 31432255 - 31432292
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcc |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31432255 |
acaaccccacaaaaccggcttgtgaggtgaggattgcc |
31432292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 111
Target Start/End: Complemental strand, 38733203 - 38733119
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||| |||||||| |||| |||| | |||||||||||||||||||||| | || ||| | ||||||||||||||||||| |
|
|
| T |
38733203 |
cacaaaaccgacttgtgagatgagaattgtc-ccacttataaacacattgtcagaccatcacatattcgatgtggaactcttaaca |
38733119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 51590097 - 51590039
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
51590097 |
acaatcccacaaaaccggcttgtgaggtgaggattgc--tcacttataaacaaattgtcag |
51590039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 79
Target Start/End: Original strand, 7826068 - 7826116
Alignment:
| Q |
31 |
aaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||| ||||||| | |||||||||||||||||||||| |
|
|
| T |
7826068 |
aaccggcttgtgaggtaaggattgtccccacttataaacacattgtcag |
7826116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 9499304 - 9499245
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||| | ||||||||||| |||||||| |
|
|
| T |
9499304 |
acaaccccacaaaaccgg-ttgtgaggtgaagattgcccctacttataaacatattgtcag |
9499245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 51459730 - 51459822
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| ||||||||||| |||||| || || |||||||| ||||||||||||||||||| |||| || | | |||||| ||| |||||||||| |
|
|
| T |
51459730 |
acaatcccacaaaaccagcttgtaagatgcggattgcccccacttataaacacattgttaggctatcacctatccgatatgggactcttaaca |
51459822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 43 - 111
Target Start/End: Original strand, 51459879 - 51459947
Alignment:
| Q |
43 |
aggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| || | | |||||||||| |||||||||| |
|
|
| T |
51459879 |
aggtgaggattgcccccacttataaacacattgttaggccatcacctatccgatgtgggactcttaaca |
51459947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 44 - 111
Target Start/End: Complemental strand, 13386282 - 13386215
Alignment:
| Q |
44 |
ggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||| || | ||||||| |||||||| ||||| ||||| | ||||||||||||||||||||| |
|
|
| T |
13386282 |
ggtgaggattaccccaacttatatacacattgccaggccatgtcctatccgatgtggaactcttaaca |
13386215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 32952130 - 32952071
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
||||||| | ||||||| ||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
32952130 |
acaacccaaaaaaaccgacttgtgagggaaggattggctccacttataaacacattgtca |
32952071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 23 - 110
Target Start/End: Complemental strand, 39808520 - 39808434
Alignment:
| Q |
23 |
ccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaac |
110 |
Q |
| |
|
|||||||||||||| ||| | ||||||||||| | |||||||||||||||||||||| | || ||| ||| |||||| ||||||||| |
|
|
| T |
39808520 |
ccccacaaaaccggtttggg-ggtgaggattgtccccacttataaacacattgtcagaccatcacatatccaatgtgggactcttaac |
39808434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 73
Target Start/End: Complemental strand, 41066999 - 41066944
Alignment:
| Q |
18 |
aacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||| |||||| |||||| ||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
41066999 |
aacaagcccacacaaccggtttgtgaggtgaagattacctccacttataaacacat |
41066944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 70
Target Start/End: Complemental strand, 52127779 - 52127729
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52127779 |
acaaccccacaaaagcagcttgtgaggtgaggattgcc-ccacttataaaca |
52127729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 74
Target Start/End: Original strand, 4098432 - 4098482
Alignment:
| Q |
24 |
cccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacatt |
74 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
4098432 |
cccacaaaaccaacttgtaaggtgaggattgcccccacttataaacacatt |
4098482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 11924980 - 11924886
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||| | | || ||||||||||||| |||||||| | || | | ||||||||| ||||||||||||| |
|
|
| T |
11924980 |
acaacctcacaaaaccggtttgtaaggtgagaaatacccccacttataaacatattgtcagaccatcacctatccgatgtgtaactcttaacaat |
11924886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 49143012 - 49142958
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||| ||||||||| |||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
49143012 |
acaatcccacaaaattggcttgtgagctgaggattgcccccacttataaacacat |
49142958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 59
Target Start/End: Complemental strand, 11590507 - 11590474
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11590507 |
cacaaaaccggcttgtgaggtgaggattgcctcc |
11590474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 59
Target Start/End: Complemental strand, 11590674 - 11590641
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11590674 |
cacaaaaccggcttgtgaggtgaggattgcctcc |
11590641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 25255370 - 25255314
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | ||||| |||||||||||| |
|
|
| T |
25255370 |
acaaccccacaaaaccggcttgtgaggtgagaattgtcatcactt-taaacacattgt |
25255314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 56
Target Start/End: Complemental strand, 35772088 - 35772051
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcc |
56 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35772088 |
acaaccccacaaaaccggcttgcgaggtgaggattgcc |
35772051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 20 - 69
Target Start/End: Original strand, 50695860 - 50695909
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaac |
69 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| || ||||||||||| |
|
|
| T |
50695860 |
caaccccacaaaaccggcttgtgagctgaggattaccctcacttataaac |
50695909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 11234275 - 11234223
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | || | |||||||||||||| |
|
|
| T |
11234275 |
acaaccccacaaaaccggcttatgaggtgagaactgtccccacttataaacac |
11234223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 107
Target Start/End: Complemental strand, 17468399 - 17468315
Alignment:
| Q |
23 |
ccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
||||||| ||| | || ||||| ||||||||||| ||||||||||||| |||||||| | || || | |||||||||| |||||| |
|
|
| T |
17468399 |
ccccacataacggactggtgagatgaggattgcccccacttataaacatattgtcagaccatctcttatccgatgtgggactctt |
17468315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 29898971 - 29898919
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
|||||| ||||||||||||||||| |||||| |||||| ||||||||||||| |
|
|
| T |
29898971 |
acaacctcacaaaaccggcttgtgtggtgagaattgccctcacttataaacac |
29898919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 9146889 - 9146940
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaaca |
70 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||| | || |||||||||| |
|
|
| T |
9146889 |
acaactccacaaaaccggcttgtgaggagaggattgaccccgcttataaaca |
9146940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 27 - 110
Target Start/End: Complemental strand, 17412387 - 17412304
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaac |
110 |
Q |
| |
|
|||||||||| || |||||| |||||| | ||||||||||||||||| |||| |||| || | ||||||||| ||||||||| |
|
|
| T |
17412387 |
acaaaaccggtttacgaggtgcggattgtccccacttataaacacattatcagacaatctcctatccgatgtgagactcttaac |
17412304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 7653294 - 7653241
Alignment:
| Q |
25 |
ccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||| |||||| |||||| |||||||| |
|
|
| T |
7653294 |
ccacaagaccagcttgtgaggtgaggattgcc-ccacttttaaacaaattgtcag |
7653241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 9146579 - 9146633
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||| ||| ||||| |||||| |
|
|
| T |
9146579 |
acaacccaacaaaaccgttttgtgaggtgaggattgcccccagttatatacacat |
9146633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 73
Target Start/End: Original strand, 12376470 - 12376516
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||||| ||||||| |||| ||||||| |||||||||||||||| |
|
|
| T |
12376470 |
acaaaaccgacttgtgaagtgaagattgcccccacttataaacacat |
12376516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 60
Target Start/End: Original strand, 24382585 - 24382619
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctcca |
60 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
24382585 |
cacaaaaccggcttgtgaggtgagtattgcctcca |
24382619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 26229627 - 26229573
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||| | ||| ||| ||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
26229627 |
acaaccctaaaaatccgacttatgaggtgaggattgccttcacttataaacacat |
26229573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 32223822 - 32223768
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||||||| ||| |||||||||| ||||||| ||| |||| ||||||||||| |
|
|
| T |
32223822 |
acaaccccacacaactggcttgtgagatgaggatcgcccccacatataaacacat |
32223768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 61 - 111
Target Start/End: Complemental strand, 33156986 - 33156936
Alignment:
| Q |
61 |
cttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||||| | || || | ||||||||||||||||||||| |
|
|
| T |
33156986 |
cttataaacacattgtcagaccatctcctatccgatgtggaactcttaaca |
33156936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 20 - 73
Target Start/End: Original strand, 102092 - 102144
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||| |||| | |||||||||||||| |
|
|
| T |
102092 |
caaccctacaaaaccggcttgtaaggtgaggaatgcc-caacttataaacacat |
102144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 38 - 71
Target Start/End: Original strand, 2464835 - 2464868
Alignment:
| Q |
38 |
ttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
2464835 |
ttgtgaggtgaggattacctccacttataaacac |
2464868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 3477201 - 3477262
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcagg |
80 |
Q |
| |
|
||||||||||| || ||| || |||||| ||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
3477201 |
acaaccccacacaatcgggttatgaggtaaggatcgcccccacttataaacacattatcagg |
3477262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 20 - 53
Target Start/End: Original strand, 12325586 - 12325619
Alignment:
| Q |
20 |
caaccccacaaaaccggcttgtgaggtgaggatt |
53 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
12325586 |
caaccccacaaaactggcttgtgaggtgaggatt |
12325619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 31 - 68
Target Start/End: Original strand, 25460731 - 25460768
Alignment:
| Q |
31 |
aaccggcttgtgaggtgaggattgcctccacttataaa |
68 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
25460731 |
aaccggcttgtaaggtgaggattgcccccacttataaa |
25460768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 21 - 54
Target Start/End: Complemental strand, 26603485 - 26603452
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattg |
54 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
26603485 |
aaccccacaaaaccggcttatgaggtgaggattg |
26603452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 56
Target Start/End: Complemental strand, 33156792 - 33156755
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcc |
56 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
33156792 |
acaaccccacaaaaccggtttgtgagatgaggattgcc |
33156755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 38 - 111
Target Start/End: Original strand, 35303484 - 35303557
Alignment:
| Q |
38 |
ttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||| ||||||| |||| ||||||||||||| |||||||||| |||| | |||||||||| |||||||||| |
|
|
| T |
35303484 |
ttgtaaggtgagaattgtctccacttataaatacattgtcagatcatgttctatccgatgtgggactcttaaca |
35303557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 73
Target Start/End: Original strand, 12325331 - 12325375
Alignment:
| Q |
29 |
aaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||||| ||||||| |||| ||||||| |||||||||||||||| |
|
|
| T |
12325331 |
aaaaccgacttgtgaagtgaagattgcccccacttataaacacat |
12325375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 51
Target Start/End: Original strand, 12509517 - 12509549
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgagga |
51 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
12509517 |
acaaacccacaaaaccggcttgtgaggtgagga |
12509549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 29266012 - 29265968
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccactt |
63 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| |||||| |||||| |
|
|
| T |
29266012 |
acaaccccacaaaaccagcttgtaaggtgagtattgcccccactt |
29265968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 29273243 - 29273275
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
29273243 |
acaaaaccggcttgtaaggtgaggattgcctcc |
29273275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 39649102 - 39649134
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
39649102 |
acaaaaccggcttgtaaggtgaggattgcctcc |
39649134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 43361570 - 43361602
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
43361570 |
acaaaaccggcttgtaaggtgaggattgcctcc |
43361602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 51460467 - 51460519
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
||||||||||||||| ||||||| | |||| |||| || |||||||||||||| |
|
|
| T |
51460467 |
acaaccccacaaaactggcttgtaaagtgaagattaccaccacttataaacac |
51460519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 52846867 - 52846899
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
52846867 |
acaaaaccggcttgtaaggtgaggattgcctcc |
52846899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 110 - 212
Target Start/End: Complemental strand, 9298 - 9195
Alignment:
| Q |
110 |
caatgtgtaagaagttttggatacaaaaactttggattcacatcctttttgccttgtcatgcaaaactctct-gcacatcctgtaatggaccattcatct |
208 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||| ||||||||| |||||||||| ||||||||||||| ||| ||||||||||||||||||||| | ||| |
|
|
| T |
9298 |
caatgtgtaaggagttttgcatacaaaaactttagattcacattctttttgcctcgtcatgcaaaactgtctggcacatcctgtaatggaccatccttct |
9199 |
T |
 |
| Q |
209 |
cagt |
212 |
Q |
| |
|
|||| |
|
|
| T |
9198 |
cagt |
9195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0692 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: scaffold0692
Description:
Target: scaffold0692; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 5779 - 5870
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaac |
110 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||| | ||||| | |||||||||| ||||||||| |
|
|
| T |
5779 |
acaaccccgcaaaaccggcttgtgagatgaggattgcccccacttataaacacattgtcagactatgtcttatccgatgtgggactcttaac |
5870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0692; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 5569 - 5628
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
5569 |
acaaccccgcaaaaccggcttgtgaagtgaggattgcccccacttataaacacattgtca |
5628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0766 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: scaffold0766
Description:
Target: scaffold0766; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 6333 - 6241
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| | || || | || ||||||| |||||||||| |
|
|
| T |
6333 |
acaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaacacattgtcagactatctcttatctgatgtgggactcttaaca |
6241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 4454 - 4516
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
4454 |
acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgtcaggc |
4516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 27 - 111
Target Start/End: Complemental strand, 20626 - 20542
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||| |||||| |||||||||||||| ||| |||||||||||||||||||| || || |||||||||||| |||||||||| |
|
|
| T |
20626 |
acaaaaccagcttgtaaggtgaggattgcccccaattataaacacattgtcaggccatatcctgtccgatgtgggactcttaaca |
20542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 69558 - 69649
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaac |
110 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||| ||||||||||||| |||||||||| |||| | |||| ||||| ||||||||| |
|
|
| T |
69558 |
acaaccccataaaaccggtttgtgaggtgaggattgcccccacttataaacagattgtcaggccatgttctatccgttgtgggactcttaac |
69649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0181 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: scaffold0181
Description:
Target: scaffold0181; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 20998 - 20938
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||| |
|
|
| T |
20998 |
acaaccccacaaaaccggcttgtgaggtgaggattaccttcacttataaatacattgtcag |
20938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0129 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: scaffold0129
Description:
Target: scaffold0129; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 14362 - 14302
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
14362 |
acaaccccacaaaaccggcttgtgaggtgatgattgtccccacttataaacacattgtcag |
14302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0048 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: scaffold0048
Description:
Target: scaffold0048; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 81901 - 81809
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
||||||||||||||||| ||||| |||||| |||| | ||||||||||||| |||||||||| |||| |||||||||||| |||||||||| |
|
|
| T |
81901 |
acaaccccacaaaaccgacttgtaaggtgaaaattgtccccacttataaacatattgtcaggccatgttctgtccgatgtgggactcttaaca |
81809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0048; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 82135 - 82043
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||| |||| | |||||||| || ||| ||||| |||||||||||||| |||||||||| ||||||| |||||||||| |
|
|
| T |
82135 |
acaaccccacaaaaccggtttgtaatttgaggatttcccccatttatatacacattgtcaggccatgtcatgtctgatgtgggactcttaaca |
82043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0083 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold0083
Description:
Target: scaffold0083; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 51295 - 51236
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51295 |
acaaccccacaaaactgacttgtgaggtgaggattgcccccacttataaacacattgtca |
51236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0729 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: scaffold0729
Description:
Target: scaffold0729; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 27 - 111
Target Start/End: Complemental strand, 2562 - 2476
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccactt-ata-aacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||| ||| ||| ||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
2562 |
acaaaaccggcttgtgaggtgaggattgtctcctctttatanaactcattgtcaggccatgtcatatccgatgtgggactcttaaca |
2476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0092 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 5714 - 5620
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaacaat |
113 |
Q |
| |
|
||||||||||||||||||||||| || |||||||| || ||||||||||||||||||||| || || | | || ||||||| |||||||||||| |
|
|
| T |
5714 |
acaaccccacaaaaccggcttgtaagatgaggattacccccacttataaacacattgtcatgccatcttctatctgatgtgggactcttaacaat |
5620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0092; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 111
Target Start/End: Complemental strand, 5941 - 5857
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaaca |
111 |
Q |
| |
|
|||||| ||||||| |||||||||||| | |||||||||||| ||||||| || || | | |||||||||||||| |||||| |
|
|
| T |
5941 |
acaaaatcggcttgaaaggtgaggattgtcctcacttataaacatattgtcatgccatcttctatccgatgtggaactgttaaca |
5857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0481 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0481
Description:
Target: scaffold0481; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 3496 - 3555
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| | ||||||||||||| ||||||| |
|
|
| T |
3496 |
acaaccccacaaaaccggcttgtgaggtgaagattgtccccacttataaacaaattgtca |
3555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0400 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0400
Description:
Target: scaffold0400; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 3904 - 3841
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| || |||||||| ||||||||||||||| |
|
|
| T |
3904 |
acaaccccacaaaactggcttgtgaggtgaggattgccccccacttattaacacattgtcaggc |
3841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0365 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0365
Description:
Target: scaffold0365; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 81
Target Start/End: Complemental strand, 4548 - 4485
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| || |||||||| ||||||||||||||| |
|
|
| T |
4548 |
acaaccccacaaaactggcttgtgaggtgaggattgccccccacttattaacacattgtcaggc |
4485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 56518 - 56458
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcag |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| || ||||||||| |||||||| |
|
|
| T |
56518 |
acaaccccacaaaaccggcttgtgaggtgatgattgcccacagttataaacaaattgtcag |
56458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 107
Target Start/End: Original strand, 288682 - 288770
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactctt |
107 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||| ||| |||||| |||||||||| | || || | |||||||||| |||||| |
|
|
| T |
288682 |
acaactccacaaaaccagcttgtgaggtgaggattgcgcccagatataaatacattgtcagaccatctcctatccgatgtgggactctt |
288770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 78
Target Start/End: Complemental strand, 121610 - 121553
Alignment:
| Q |
21 |
aaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
||||||||||||||||||||||| | |||||| ||| ||||||| ||||||||||||| |
|
|
| T |
121610 |
aaccccacaaaaccggcttgtgatgggaggatggcccccacttacaaacacattgtca |
121553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 12706 - 12647
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtca |
78 |
Q |
| |
|
|||||| ||||||| || |||||||||||||||||||| |||| |||||| ||||||||| |
|
|
| T |
12706 |
acaaccacacaaaatcgacttgtgaggtgaggattgcccccacatataaatacattgtca |
12647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 67337 - 67283
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||| |||| |||||| ||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
67337 |
acaatcccataaaaccagcttgtgaggtgatgattgcccccacttataaacacat |
67283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 67544 - 67490
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
||||| |||||||| ||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
67544 |
acaactccacaaaatcggtttgtaaggtgaggattgcccccacttataaacacat |
67490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 347596 - 347648
Alignment:
| Q |
19 |
acaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacac |
71 |
Q |
| |
|
|||||||||||||||||||||||||||| | || |||| ||| |||||||||| |
|
|
| T |
347596 |
acaaccccacaaaaccggcttgtgaggtaaagactgcccccaattataaacac |
347648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 30 - 73
Target Start/End: Original strand, 102178 - 102221
Alignment:
| Q |
30 |
aaaccggcttgtgaggtgaggattgcctccacttataaacacat |
73 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
102178 |
aaaccggcttgtgaggtggcgattgcccccacttataaacacat |
102221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 13384 - 13330
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||| | |||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
13384 |
acaaaaccagtttgtgaggtgaggattgcactcacttacaaacacattgtcaggc |
13330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 76
Target Start/End: Complemental strand, 13147 - 13103
Alignment:
| Q |
32 |
accggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||||| ||||| |
|
|
| T |
13147 |
accggcttgtgaggtgatgattgcccccacttacaaacatattgt |
13103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 11025 - 10971
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||| | |||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
11025 |
acaaaaccagtttgtgaggtgaggattgcactcacttacaaacacattgtcaggc |
10971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 14691 - 14637
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggc |
81 |
Q |
| |
|
|||||||| | |||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
14691 |
acaaaaccagtttgtgaggtgaggattgcactcacttacaaacacattgtcaggc |
14637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 76
Target Start/End: Complemental strand, 10788 - 10744
Alignment:
| Q |
32 |
accggcttgtgaggtgaggattgcctccacttataaacacattgt |
76 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||||| ||||| |
|
|
| T |
10788 |
accggcttgtgaggtgatgattgcccccacttacaaacatattgt |
10744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 69
Target Start/End: Original strand, 34664 - 34710
Alignment:
| Q |
23 |
ccccacaaaaccggcttgtgaggtgaggattgcctccacttataaac |
69 |
Q |
| |
|
|||||||||||||| |||| ||||||||| ||||||| ||||||||| |
|
|
| T |
34664 |
ccccacaaaaccggtttgtaaggtgaggagtgcctcctcttataaac |
34710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0434 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0434
Description:
Target: scaffold0434; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 59
Target Start/End: Complemental strand, 13393 - 13360
Alignment:
| Q |
26 |
cacaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
13393 |
cacaaaaccggcttgtaaggtgaggattgcctcc |
13360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 429898 - 429841
Alignment:
| Q |
53 |
tgcctccacttataaacacattgtcaggcaatgtcatgtccgatgtggaactcttaac |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||| || | | |||||||||| ||||||||| |
|
|
| T |
429898 |
tgcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaac |
429841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0029
Description:
Target: scaffold0029; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Complemental strand, 76938 - 76906
Alignment:
| Q |
27 |
acaaaaccggcttgtgaggtgaggattgcctcc |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
76938 |
acaaaaccggcttgtaaggtgaggattgcctcc |
76906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University