View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2123_high_8 (Length: 213)
Name: NF2123_high_8
Description: NF2123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2123_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 95 - 195
Target Start/End: Complemental strand, 2532318 - 2532218
Alignment:
| Q |
95 |
cgaactttagagacacaattttataaaccttattccatggccaggtccacaagtaatccttatagcattgacaaaagtggaaccaccattgacggcaata |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
2532318 |
cgaactttagagacacaattttataaaccttattccatggccaggtccacaagtaatccttatagcattgacaaaagtagaaccaccattgactgcaata |
2532219 |
T |
 |
| Q |
195 |
c |
195 |
Q |
| |
|
| |
|
|
| T |
2532218 |
c |
2532218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 96 - 195
Target Start/End: Complemental strand, 2541909 - 2541810
Alignment:
| Q |
96 |
gaactttagagacacaattttataaaccttattccatggccaggtccacaagtaatccttatagcattgacaaaagtggaaccaccattgacggcaatac |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
2541909 |
gaactttagagacacaattttataaaccttattccatggccaggtccacaagtaatccttgtagcattgacaaaagaggagccaccattgatggcaatac |
2541810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 114 - 195
Target Start/End: Complemental strand, 2550158 - 2550077
Alignment:
| Q |
114 |
tttataaaccttattccatggccaggtccacaagtaatccttatagcattgacaaaagtggaaccaccattgacggcaatac |
195 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||| || ||||||||| ||||||||| |||||||| || ||||||| |
|
|
| T |
2550158 |
tttataaaccttatcccatggcctggtccacaagtaacccgagtagcattgataaaagtggagccaccatttactgcaatac |
2550077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University