View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21240_high_12 (Length: 264)
Name: NF21240_high_12
Description: NF21240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21240_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 252
Target Start/End: Complemental strand, 40836828 - 40836596
Alignment:
| Q |
19 |
acacaatcagccagagagaatcatttagttcataatgatcgaagtagcttcacatttaagtttgtgtttggaacttatttttgacaaatagcatgtggtt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40836828 |
acacaatcagccagagagaatcatttagttcataatgatcgaagtagcttcacatttaagtttgtgtttggaacttatttttgacaa-tagcatgtggtt |
40836730 |
T |
 |
| Q |
119 |
ggaacttaaatttcattaaacatgctaatacggatgaaggttctgacacatactaatgcttgttagtttttagagaaggcagggccaaaattaatttcaa |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40836729 |
ggaacttaaacttcattaaacatgctaatacggatgaaggttctgacacatactaatgcttgttagtttttagagaaggcagggccaaaattaatttcaa |
40836630 |
T |
 |
| Q |
219 |
acacctgaaattggtttttgacatgtttgatgat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40836629 |
acacctgaaattggtttttgacatgtttgatgat |
40836596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University