View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21240_high_6 (Length: 350)
Name: NF21240_high_6
Description: NF21240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21240_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 75 - 347
Target Start/End: Original strand, 194311 - 194583
Alignment:
| Q |
75 |
aatcctttcattctatgggtttcggatgttgctcaatccctggccctcccttctgctttgctttggattcaatcatgtgcttccttctcttcttactatc |
174 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
194311 |
aatcctttcattccatgggtttctgatgttgctcaatccctttccctcccttctgctttgctttggattcaatcatgtgcttccttctctacttactatc |
194410 |
T |
 |
| Q |
175 |
attactatcataaattagtttctttcccttctcaatcccatccccatattcatgttcagctgccatgtatgcctctgttgaattatgatcaagtccctag |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194411 |
attactatcataaattagtttctttcccttctcaatcccatccccatattcatgttcagctgccatgtatgcctctgttgaattatgatcaagtccctag |
194510 |
T |
 |
| Q |
275 |
cttcttgtatcccaccactccctatccatttcttagaagggcgatcctgggacagttccaaaacttgcataaa |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
194511 |
cttcttgtatcccaccactccctatccatttcttagaagggcgatcttgggacagttccaaaacttgcataaa |
194583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 194213 - 194149
Alignment:
| Q |
18 |
tcaagccgtgttggttcattctcagcccaaccatcttcaaaccagtcaaaactaataaatccttt |
82 |
Q |
| |
|
||||||||| ||||||||| |||| ||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
194213 |
tcaagccgttttggttcatcctcatcccaaccatcttcaaaccattcaaatctaataaatccttt |
194149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University