View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21240_low_15 (Length: 247)
Name: NF21240_low_15
Description: NF21240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21240_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 48015788 - 48016002
Alignment:
| Q |
19 |
actgtttcatttgcaagtagtgagtgatccttgcttacacacatccagcacggttcttattattgtttaaatggagccttgcatatgaaactcttttcaa |
118 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48015788 |
actgtttcatttgcaagtagcgagtaatccttgcttacacacatccagcacggttcttattattgtgtaaatggagccttgcatatgaaactcttttcaa |
48015887 |
T |
|
| Q |
119 |
gatggtaccttgaaaagaaactccatttgcacaaacaatgacttaaatacaagtatacgtagaaatttatattacaaaaccaaaaataaaagacgatatc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48015888 |
gatggtaccttgaaaagaaactccatttgcacaaacaatgacttaaatacaagtatacgtagaaaattatattacaaaaccaaaaataaaagacgatatc |
48015987 |
T |
|
| Q |
219 |
ttaaaaagatgacac |
233 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
48015988 |
ttaaaaagatgacac |
48016002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University