View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21241_high_10 (Length: 236)
Name: NF21241_high_10
Description: NF21241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21241_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 100 - 221
Target Start/End: Complemental strand, 53488891 - 53488770
Alignment:
| Q |
100 |
tggtattttaaattctctaaatttacatgatctcataatcctcttgatcaacttgtctttgcttttcagattttctattgacggcagaccaattagggaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53488891 |
tggtattttaaattctctaaatttacatgatctcataatcctcttgatcaacttgtccttgcttttcagattttctattgacggcagaccaattagggaa |
53488792 |
T |
 |
| Q |
200 |
ttcaaaaacttggagagtgaag |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
53488791 |
ttcaaaaacttggagagtgaag |
53488770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 53489017 - 53488916
Alignment:
| Q |
1 |
aatccttaaatttgataaataaacagagataaatatacaaaatttgaaacacataggaactatttgtgtacacaatatgaacaaattatatggaccaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53489017 |
aatccttaaatttgataaataaacagagataaatatacaaaatttgaaacacataggaactatttgtgtacacaatatgaacaaattatatggaccaatt |
53488918 |
T |
 |
| Q |
101 |
gg |
102 |
Q |
| |
|
|| |
|
|
| T |
53488917 |
gg |
53488916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University