View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21241_low_6 (Length: 352)
Name: NF21241_low_6
Description: NF21241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21241_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 3 - 340
Target Start/End: Complemental strand, 36894524 - 36894187
Alignment:
| Q |
3 |
actaatatcattcttcataaccttgtccagatttcatcagctagctgagtttgatcaaggaaaaagaagttgtcggagacgactagctggtcataatgag |
102 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36894524 |
actaatatcattcttcataaccttgcccagatttcatcagcttgctgagtttgatcaaggaaaaagaagttgtcggagacgactagctggtcataatgag |
36894425 |
T |
 |
| Q |
103 |
cgtcgcagaaagcccccacccagctctctcttaacctcacgttttgccaggctttcttcatctgtttttggttagaaactatcagtaaaatttaatttca |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36894424 |
cgtcgcagaaagcccccacccagctctctcttaacctcacgttttgccaggctttcttcgtctgtttttggttagaaactatcagtaaaatttaatttca |
36894325 |
T |
 |
| Q |
203 |
aatccctctactttccgtttttgttcaattggttatttttcaacttgcactatatttctggcacatgaaacaatttcaaatatttgacacttttatcgac |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36894324 |
aatccctctactttccgtttttgttcaattggttatttttcaacttgtactatatttctggcacattaaacaatttcaaatatttgacacttttatcgac |
36894225 |
T |
 |
| Q |
303 |
aggtaacagcgacagaggtggcagctttttgatggaat |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36894224 |
aggtaacagcgacagaggtggcagctttttgatggaat |
36894187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University