View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_high_110 (Length: 210)
Name: NF21242_high_110
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_high_110 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 517822 - 518014
Alignment:
| Q |
1 |
caacacgtgtgcatgtggttgtgatgatgatggcacaaatcatcattgtaatccaaatgcaagagcaatgcttttaccttcagaagctcttcttgtacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
517822 |
caacacgtgtgcatgtggttgtgatgatgatgacacaaatcgtcattgtaatccaaatgcaagagcaatgcttttaccttcagaagctcttcttgtacct |
517921 |
T |
|
| Q |
101 |
tttgagaatagaacattgaagacagttgcttgggcaaaattaaagcattttagggtacctaagaaactaccatgtggtgataattgtggagtt |
193 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
517922 |
ttcgagaatagaacattgaagacagttgcttgggcgaaattaaagcattttagggtacctaagaaattaccatgtggtgataattgtggagtt |
518014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University