View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_high_36 (Length: 413)
Name: NF21242_high_36
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_high_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 19 - 412
Target Start/End: Complemental strand, 48606011 - 48605620
Alignment:
| Q |
19 |
gttcgaggctgttttcgtcttcaatcagaaatcttcaaccattggaccaaatgtctcctgtttcatcctctccgcaattgccatcaaatgctccttttgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48606011 |
gttcgaggctgttttcgtcttcaatcagaaatcttcaaccattggaccaaatgtctcctgtttcatcctctccgcaattgccatcaaatgctccttttgc |
48605912 |
T |
 |
| Q |
119 |
tggtcttgttatatgtgttactggtttatctaaaggtgtggattcatttcttctatgattgattggatttcgtttcttttttcttatcgtacttcaagtc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48605911 |
tggtcttgttatatgtgttactggtttatctaaaggtgtggattcatttcttctatgattgattggatttcgtttcttttttcttatcttacttcaagtc |
48605812 |
T |
 |
| Q |
219 |
attgcctaaattctacaaaattgttttcatagcatgttcatatacttgagcttgaaaagaggtatannnnnnnnnattgatattcatactgtgatgttgt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
48605811 |
attgcctaaattctacaaaattgttttcatagcatgttcatatacttgagcttgaaaaggtgtata---ttttttattgatattcatactgtgatgttgt |
48605715 |
T |
 |
| Q |
319 |
taatgttattctatgaattggcgttttggcagaagcaaggaatcaggtcatggaggctacagagaga-taggtggccagtatagccccaatctgc |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48605714 |
taatgttattctatgaattggcgttttggcagaagcaaggaatcaggtcatggaggctacagagagattaggtggccagtatagccccaatctgc |
48605620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University