View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_high_56 (Length: 353)
Name: NF21242_high_56
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_high_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 342
Target Start/End: Original strand, 29769094 - 29769432
Alignment:
| Q |
1 |
cgtcgaatgcagaatgggtggaggaagacgaagaggagcttcattgggcggcgctttcacgtttaccgtcgcagaaacgcatcaactttgccgtcctccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29769094 |
cgtcgaatgcagaatgggtggaggaagacgaagaggagcttcattgggcggcgctttcacgtttaccgtcgcagaaacgcatcaacttcgccgtcctccg |
29769193 |
T |
|
| Q |
101 |
tgcttcatcttcccgtcaaccttcaaaggaaaatgccgccgagaatttagtcgatgtgagaaaattgaatcggtttaatcgtgaactcgtcgttaaaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29769194 |
tgcttcatcttcccgtcaaccttcaaaggaaaatgccggcgagaatttagtcgatgtgagaaaattgaatcggtttaatcgtgaactcgtcgttaaaaaa |
29769293 |
T |
|
| Q |
201 |
gcactcgctacaaatgatcaagataattataagcttctctccgctgttaaagaacgcctcaataggttcgttgttcatgtctctatcatcgttatagatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29769294 |
gcactcgctacaaatgatcaagataattataagcttctctccgccgttaaagaacgcctcaataggttcgttgttcatgtctctatcatcgttatagatc |
29769393 |
T |
|
| Q |
301 |
tttatgttaatgttgtatccggtgtctgtagctaacggtatc |
342 |
Q |
| |
|
| ||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
29769394 |
tgtatgtcaatgttgtat---gtgtctgtagctaacggtatc |
29769432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University