View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_high_62 (Length: 332)
Name: NF21242_high_62
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_high_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 189 - 318
Target Start/End: Original strand, 41250215 - 41250344
Alignment:
| Q |
189 |
tagctagaaccaattattaacccagtcccatttaaaagtgaaatcgtagctagaatccattcaaatttcgaaatgggagcaagcacaaaaacgaagaagg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41250215 |
tagctagaaccaattattaacccagtcccatttaaaagtgaaatcgttgctagaatccattcaaatttcgaaatgggagcaagcacaaaaacgaagaagg |
41250314 |
T |
 |
| Q |
289 |
gagtttaacaaaaatttcaatgctgttatt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41250315 |
gagtttaacaaaaatttcaatgctgttatt |
41250344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 13 - 146
Target Start/End: Original strand, 41250041 - 41250174
Alignment:
| Q |
13 |
atagcttggagagacaccctacaaaatagaaaacaatcatccataaacaaaagatgagtaattatcagtaaaaataaagggaaatactaaaaagatccca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
41250041 |
atagcttggagagacaccctacaaaatagaaaacaatcatccataaacaaaagatgagtaattatcagtgaaaataatggaaaatactaaaaagatccca |
41250140 |
T |
 |
| Q |
113 |
tagaatttaacatcattttacattgtccttcctt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41250141 |
tagaatttaacatcattttacattgtccttcctt |
41250174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University