View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_high_93 (Length: 258)
Name: NF21242_high_93
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_high_93 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 21 - 258
Target Start/End: Original strand, 3308140 - 3308377
Alignment:
| Q |
21 |
cagaaacaccgcgagcagcttcagaagccattataaaatgattatcaacttcactcaacacttgaatcatatccatattcactctctctttcactcttcc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308140 |
cagaaacaccgcgagcagcttcagaagccattataaaatgattatcaacttcactcaacacttgaatcatatccatattcactctctctttcactcttcc |
3308239 |
T |
|
| Q |
121 |
aacaacttcttcatcaccatcaccatcctcttcctcttccacaaccatgtctgattcaaactccggcatggtaatagcacgccggagagcagcaggcaaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308240 |
aacaacttcttcatcaccatcaccatcctcttcctcttccacaaccatgtctgattcaaactccggcatggtaatagcacgccggagagcagcaggcaaa |
3308339 |
T |
|
| Q |
221 |
tcaggaagaggaggaggaggcaaaggaacatcataaga |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308340 |
tcaggaagaggaggaggaggcaaaggaacatcataaga |
3308377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University