View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_low_105 (Length: 236)
Name: NF21242_low_105
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_low_105 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 65 - 230
Target Start/End: Original strand, 36204413 - 36204578
Alignment:
| Q |
65 |
aaaccaaattaatgtaaacaagaatttaagttctttgatttttgttttcagattattgatcggaagtgtcagaacaacaatgctcaagataaaaagtgca |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36204413 |
aaaccaaattaatgtaaacaagaatttaagttctttgattgttgttttcagattattgatcggaagtgtcagaacaacaatgctcaagatataaagtgca |
36204512 |
T |
 |
| Q |
165 |
gcccatctgcaaagaaacgtcgaaaccttaaaactaagtatgattagcttgaaacttctttcttgt |
230 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36204513 |
gcccatctgcaaagaaacgtcgaaaccgtaaaactaagtatgattagcttgaaacttctttcttgt |
36204578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 36204342 - 36204392
Alignment:
| Q |
1 |
tgcatgcatgtgatcattttctataggatgttttggtatagaattacatag |
51 |
Q |
| |
|
|||||||||||||||| || || |||||||||||||||||||||| |||| |
|
|
| T |
36204342 |
tgcatgcatgtgatcaattgttaaaggatgttttggtatagaattatatag |
36204392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 73 - 153
Target Start/End: Complemental strand, 11068407 - 11068327
Alignment:
| Q |
73 |
ttaatgtaaacaagaatttaagttctttgatttttgttttcagattattgatcggaagtgtcagaacaacaatgctcaaga |
153 |
Q |
| |
|
||||||||||||||| || ||||| ||||||| ||||||||||||||||||| |||||||| |||| ||||||| ||||| |
|
|
| T |
11068407 |
ttaatgtaaacaagacttaaagttatttgattgttgttttcagattattgataggaagtgttggaacgacaatgcacaaga |
11068327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University