View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_low_107 (Length: 230)
Name: NF21242_low_107
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_low_107 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 4 - 230
Target Start/End: Original strand, 35772394 - 35772621
Alignment:
| Q |
4 |
accaccaggtttccgattccaccctaccgatgaagaactcgttgttcactacctcaaaagaaaagctgcttctgcacctcttccagtagccatcatagca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35772394 |
accaccaggtttccgattccaccctaccgatgaagaactcgttgttcactacctcaaaagaaaagctgcttctgcacctcttccagtagccatcatagca |
35772493 |
T |
 |
| Q |
104 |
gagattgatctctacaaattcgacccatgggaactcccaagtatcaaactttttcacaccccatttcatcttttcatccatttactc-aaacccacatcc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35772494 |
gagattgatctctacaaattcgacccatgggaactcccaagtatcaaactttttcacaccccatttcatcttttcatccatttactcaaaacccacatcc |
35772593 |
T |
 |
| Q |
203 |
tagattttatgttccttgttttgcatat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
35772594 |
tagattttatgttccttgttttgcatat |
35772621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 14 - 135
Target Start/End: Original strand, 33761848 - 33761969
Alignment:
| Q |
14 |
ttccgattccaccctaccgatgaagaactcgttgttcactacctcaaaagaaaagctgcttctgcacctcttccagtagccatcatagcagagattgatc |
113 |
Q |
| |
|
|||||||| |||||||| |||||||| || |||||||| |||||||| | |||||| ||||| || ||| | ||||||||||||||||| || |||||| |
|
|
| T |
33761848 |
ttccgatttcaccctacagatgaagagcttgttgttcattacctcaagaaaaaagcagcttcagctcctttaccagtagccatcatagctgaagttgatc |
33761947 |
T |
 |
| Q |
114 |
tctacaaattcgacccatggga |
135 |
Q |
| |
|
|||||||||| || |||||||| |
|
|
| T |
33761948 |
tctacaaatttgatccatggga |
33761969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University