View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_low_109 (Length: 225)
Name: NF21242_low_109
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_low_109 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 46368037 - 46368246
Alignment:
| Q |
1 |
atatttattggaatagcttaaatgaatttcaataattggaagtnnnnnnnnnt-aggattgatgatacatacagtgttgccacatgtttccagcaagatc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46368037 |
atatttattggaatagcttaaatgaatttcaataattggaagtaaaaaaaaattaggattgatgatacatacagtgttgccacatgtttccagcaagatc |
46368136 |
T |
 |
| Q |
100 |
ttcagccttcttggtagcttcggcggctttctttccccatttaccaagaacatctttcaccgaatctaaagtatctgcgaaatcaaaactttaattgaga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46368137 |
ttcagccttcttggtagcttcggcggctttctttccccatttaccaagaacatctttcaccgaatctaaagtatctgcgaaatcaaaactttaattgaga |
46368236 |
T |
 |
| Q |
200 |
aacaagaaat |
209 |
Q |
| |
|
|||||||||| |
|
|
| T |
46368237 |
aacaagaaat |
46368246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University