View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21242_low_112 (Length: 210)

Name: NF21242_low_112
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21242_low_112
NF21242_low_112
[»] chr5 (1 HSPs)
chr5 (1-193)||(517822-518014)


Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 517822 - 518014
Alignment:
1 caacacgtgtgcatgtggttgtgatgatgatggcacaaatcatcattgtaatccaaatgcaagagcaatgcttttaccttcagaagctcttcttgtacct 100  Q
    |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
517822 caacacgtgtgcatgtggttgtgatgatgatgacacaaatcgtcattgtaatccaaatgcaagagcaatgcttttaccttcagaagctcttcttgtacct 517921  T
101 tttgagaatagaacattgaagacagttgcttgggcaaaattaaagcattttagggtacctaagaaactaccatgtggtgataattgtggagtt 193  Q
    || |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
517922 ttcgagaatagaacattgaagacagttgcttgggcgaaattaaagcattttagggtacctaagaaattaccatgtggtgataattgtggagtt 518014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University