View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_low_44 (Length: 399)
Name: NF21242_low_44
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_low_44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 316
Target Start/End: Original strand, 11353811 - 11354122
Alignment:
| Q |
1 |
gaaaattaagggtgcacaaggtgagtgagtggactaagctgtggggactataaattctgcaaaaatgcaagttgtttgtttcaaggttggcttgggtgtc |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11353811 |
gaaaattaagggtgcacaaggcgagtgagtggactaatctgtggggactataaattctgcaaaaatgcaagttgtttgtttcaaggttggcttgggtgtc |
11353910 |
T |
|
| Q |
101 |
tgccccaacatgagaaagattgcattataaaggtgtcccatgacctcttgtctgccagaaatcgagctcacatggaggctgtttgggagaaagctagatg |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11353911 |
tgccccaacatgagaaagattgtattataaaggtgtcccatgacctcttgtctgccagaaatcgagctcacatggaggctgtttgggagaaagctggatg |
11354010 |
T |
|
| Q |
201 |
caatacagaagttgatctggcaataagttttgtgcaatgtgcacactgcagttacatgtttgttcagtttgctgaaaaataactgtcaaggcaaaaagag |
300 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||| ||| |||||| |||| ||||| ||||||| ||||||||||| ||||||||||| ||||||| |
|
|
| T |
11354011 |
caatacagaagttgatctggcaatgagtgttgt----tgtagacactgtagttgcatgtctgttcagcttgctgaaaaagaactgtcaagggaaaaagaa |
11354106 |
T |
|
| Q |
301 |
gtgatgttgatggttt |
316 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
11354107 |
gtgacgttgatggttt |
11354122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University