View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_low_64 (Length: 331)
Name: NF21242_low_64
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_low_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 7 - 316
Target Start/End: Original strand, 36805119 - 36805428
Alignment:
| Q |
7 |
ctccaatgtccacaagtcccataatgggaccaatctgccccatagccgcacttcctgtcaatgcaaaaccactgttggtagcagccacaatgttagacca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36805119 |
ctccaatgtccacaagtcccataatgggaccaatctgccccatagccgcacttcctgtcaatgcaaaaccactgttggtagcagccacaatgttagacca |
36805218 |
T |
 |
| Q |
107 |
ttccttcttagtaggacgagaaggaaggaataatgcagccggagcaccaactttaacagaatcaccttcaccatcaagacccataccaccattaaacggc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36805219 |
ttccttcttagtaggacgagaaggaaggaataacgcagccggagcaccaactttaacagaatcaccttcaccatcaagacccataccaccattaaacggc |
36805318 |
T |
 |
| Q |
207 |
acacagctaataggggtcacagcatgggcatgtggcagttggtacttaagatcagaaaaatcatcactttcagtcacttttcgagaactagttttcctac |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36805319 |
acacagctaataggggtcacagcatgggcatgtggcagttggtacttaagatcagaaaaatcatcactttcagtcacttttcgagaactagttttcctac |
36805418 |
T |
 |
| Q |
307 |
tagaagattg |
316 |
Q |
| |
|
|||||||||| |
|
|
| T |
36805419 |
tagaagattg |
36805428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University