View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21242_low_68 (Length: 319)

Name: NF21242_low_68
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21242_low_68
NF21242_low_68
[»] chr7 (1 HSPs)
chr7 (10-301)||(26031523-26031813)


Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 10 - 301
Target Start/End: Original strand, 26031523 - 26031813
Alignment:
10 gcagagagggacaagtgtcattcccaaatcaaccaacccaaataggatcaaagagaatgtggttgtcttcaattgggaacttccagataatgacttcaac 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26031523 gcagagagggacaagtgtcattcccaaatcaaccaacccaaataggatcaaagagaatgtggttgtcttcaattgggaacttccagataatgacttcaac 26031622  T
110 aaacttagcaaaataccagatcaggtagctcacaagcatgggtcgaaatagtttccgatttgataaatagatctttaaaattgttaatttcatccaaaat 209  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
26031623 aaacttagcaaaataccagatcaggtagctcacaagcattggtcgaaatag-ttccgatttgataaatagatctttaaaattgttaatttcatccaaaat 26031721  T
210 ggtccatccgttgacttctactattggagctatgatgtggcacgttaacgggatatactacattgcatgttgatctcacattaaggtcatcc 301  Q
    ||||||||||||||||||||||||||||||||||| |||| || |||||   |||| |||||||||||||| ||| ||| || | |||||||    
26031722 ggtccatccgttgacttctactattggagctatgacgtggaacattaaccaaatatgctacattgcatgttcatcccacgttgacgtcatcc 26031813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University