View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_low_69 (Length: 317)
Name: NF21242_low_69
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_low_69 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 17 - 305
Target Start/End: Original strand, 48695841 - 48696129
Alignment:
| Q |
17 |
ctctctctctcactcacacacgggccatacaagtgcactctttgccatcaagcaagacatcatcttctctcaaggttttgcgtgcaaatagaaataatct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48695841 |
ctctctctctcactcacacacgggccatacaagtgcactctttgccatcaagcaagacatcatcttctctcaaggttttgcgtgcaaatagaaataatct |
48695940 |
T |
|
| Q |
117 |
ttcaaaacaagtggattcaagtttccgaatgatacccccaagcaaatcaaatctctcacaaaacaagtagtaactgttaagttaaacagtttagagtctt |
216 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48695941 |
ttcaaaacaagtggattcaagtttccaaatgatacccccaagcaaatcaaatctctcacaaaacaagtagtaactgttacgttaaacagtttagagtctt |
48696040 |
T |
|
| Q |
217 |
tccattatgtgactgttgtgctgtgctgttaaagcaggtgattcaaactacataatcgtttacagaaattacatctccaccacaggttc |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48696041 |
tccattatgtgactgttgtgctgtgctgttaaagcaggtgattcaaactacataatcgtttacagaaattacatctccaccacaggttc |
48696129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University