View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_low_76 (Length: 302)
Name: NF21242_low_76
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_low_76 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 6 - 283
Target Start/End: Original strand, 52860326 - 52860603
Alignment:
| Q |
6 |
agcagcacagatcaactcatctcattccgaaatccaagccttaacaatcttcaaactaaaccttcttgacccactcaatgccttaacaacttgggatcca |
105 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52860326 |
agcaacacaaatcaactcatctcattccgaaatccaagccttaacaatcttcaaactaaaccttcttgacccactcaatgccttaacaacttgggatcca |
52860425 |
T |
 |
| Q |
106 |
tcaacaccttcagcaccatgtgattggcatggcattctctgttacaacaacaataacagagttcacactatacgtttacctcgtcttcaactcactggtt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52860426 |
tcaacaccttcagcaccatgtgattggcatggcattctctgttacaacaacaataacagagttcacactatacgtttacctcgtcttcaactcactggtt |
52860525 |
T |
 |
| Q |
206 |
caatatcttcatcactctctaatctctcacagcttcgtaaacttagtctccattccaacaaccttaactcatcaatac |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52860526 |
caatatcttcatcactctctaatctctcacagcttcgtaaacttagtctccattccaacaaccttaactcatcaatac |
52860603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University