View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_low_8 (Length: 581)
Name: NF21242_low_8
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 283; Significance: 1e-158; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 19 - 361
Target Start/End: Original strand, 6883051 - 6883395
Alignment:
| Q |
19 |
tgttagatataccagtggtgagagctttgatgagaccagcacgacgacccttaaaatctctgaaaacttcctcaacggtgcgtggattatattgtgtgcg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6883051 |
tgttagatataccagtggtgagagctttgatgagaccagcacgacgacccttaaaatctctgaaaacttcctcaacggtgcgtggattatattgtgtgcg |
6883150 |
T |
|
| Q |
119 |
cgcgtccattgtagcttctcctggtcttgttctgagaagaatgaaagtggaagtgggtttagggttgaaagagaatttgggaagtggaagagtgagagtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6883151 |
cgcgtccattgtagcttctcctggtcttgttctgagaagaatgaaagtggaagtgggtttagggttgaaagagaatttgggaagtggaagagtgagagtg |
6883250 |
T |
|
| Q |
219 |
aagtgggagagacaggt--nnnnnnnnnnnnnnnnnagaagagcttcgcttggtgtttctgcaaagtatgagaactgagagagaagtgcaagttgtgtgt |
316 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6883251 |
aagtgggagagacaggttctctctctctctctctctagaagagcttcgcttggtgtttctgcaaagtatgagaactgagagagaagtgcaagttgtgtgt |
6883350 |
T |
|
| Q |
317 |
ctttcacaacacaataccaaacacaataaacaactctttctgttc |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6883351 |
ctttcacaacacaataccaaacacaataaacaactctttctgttc |
6883395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 493 - 570
Target Start/End: Original strand, 6883543 - 6883620
Alignment:
| Q |
493 |
gatggattttgaatttagttgttgattcgcgtcttccatttttagcaatgttgatgttttttgttttcgctatattct |
570 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6883543 |
gatggattttgaatttagttgttgatttgcgtattccatttttagcaatgttgatgttttttgttttcgagatattct |
6883620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 381 - 427
Target Start/End: Original strand, 6883409 - 6883455
Alignment:
| Q |
381 |
gaggttttgttgcgataattttcatcgatgatttagacgttaacgtt |
427 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
6883409 |
gaggttttgttgcaaaaattttcatcgatgatttagacgttaacgtt |
6883455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University