View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_low_80 (Length: 295)
Name: NF21242_low_80
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_low_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 9168200 - 9168018
Alignment:
| Q |
18 |
gaacctgcctttgaaatcatcctgttgcggatgcggtgtaaccacctgtctctacggaagcaattgcaagcacatgactctttgttcaacctgcggcaaa |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9168200 |
gaacctgcaattgaaatcatcctgttgcggatgcggtgtaaccaccggtctctacggaagcaattgcaagcacatgactctttgttcaacctgcggcaaa |
9168101 |
T |
 |
| Q |
118 |
accatggcgaaaaatcgctctaaatgctccacctgtggcaccaccctcactcgtttgattcgagtacgatcacgttcattgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9168100 |
accatggcgaaaaatcgctctaaatgctccacctgtggcaccaccctcactcgtttgattcgagtacgatcacgttcattgaa |
9168018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 44 - 183
Target Start/End: Complemental strand, 9156517 - 9156378
Alignment:
| Q |
44 |
gcggatgcggtgtaaccacctgtctctacggaagcaattgcaagcacatgactctttgttcaacctgcggcaaaaccatggcgaaaaatcgctctaaatg |
143 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||| ||||| |||| | |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
9156517 |
gcggatgcggtgaaaccaccggtctctacggaagcaattgcaagcacttgactatttgcgccccctgtggcaaaaccatggcggaaaatcgctctaaatg |
9156418 |
T |
 |
| Q |
144 |
ctccacctgtggcaccaccctcactcgtttgattcgagta |
183 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
9156417 |
ctccacctgtggcgcgttgctcactcgtttgattcgagta |
9156378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University