View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_low_85 (Length: 283)
Name: NF21242_low_85
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_low_85 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 162 - 265
Target Start/End: Complemental strand, 5670339 - 5670236
Alignment:
| Q |
162 |
caggttctgctcgttcactgcagagattttgtgtttccctaggatttttggtttgctccaacgctgnnnnnnnnnncttccagttctgctgacgctgatc |
261 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
5670339 |
caggttctgctccatttctgcagagattttgtgtttccctaggattttttgtttgctccaacgctgttttttttttcttccagttctgctgatgctgatc |
5670240 |
T |
|
| Q |
262 |
tatt |
265 |
Q |
| |
|
|||| |
|
|
| T |
5670239 |
tatt |
5670236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 162 - 227
Target Start/End: Complemental strand, 5694008 - 5693943
Alignment:
| Q |
162 |
caggttctgctcgttcactgcagagattttgtgtttccctaggatttttggtttgctccaacgctg |
227 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5694008 |
caggttctgctccatttctgcagagattttgtgtttccctaggatttttggtttgctccagcgctg |
5693943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 162 - 223
Target Start/End: Complemental strand, 5679832 - 5679771
Alignment:
| Q |
162 |
caggttctgctcgttcactgcagagattttgtgtttccctaggatttttggtttgctccaac |
223 |
Q |
| |
|
|||||||||||| | |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5679832 |
caggttctgctccatttctgcagagatttcgtgtttccctaggatttttggtttgctccaac |
5679771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University