View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_low_91 (Length: 266)
Name: NF21242_low_91
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_low_91 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 12 - 198
Target Start/End: Original strand, 54106618 - 54106805
Alignment:
| Q |
12 |
ttaatgcacaagttagcaagacctttatagcaaaataagtgacctttttcttatacacaagaccaaaaaa-tctgtattttttcttcttataaactgact |
110 |
Q |
| |
|
|||||||| |||||| || |||| |||||||| |||||| |||||||||||||| ||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
54106618 |
ttaatgcagaagttaacatgacccttatagcataataagcatcctttttcttatactcaagaccaaaaaaatttgtattttttcttcttataaactgact |
54106717 |
T |
 |
| Q |
111 |
tgaggcagaaaatactagtatgagaacatctctaatggtaggtattcttttaaggaacctgttttgagtttcatagaccactaataag |
198 |
Q |
| |
|
||||| || ||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
54106718 |
tgaggtaggaaatactagtatgagaacatctcagatggtaggtattcttttaaggaacctcttttgagtttcatagaccactgataag |
54106805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University