View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_low_94 (Length: 260)
Name: NF21242_low_94
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_low_94 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 1460130 - 1460370
Alignment:
| Q |
18 |
atctacctcctcctccacagcctccaccgttgaagtttccggctgagacattctgttacgacggcaaggtgttcttcatgattaggttgacaaacagggt |
117 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1460130 |
atctacctcctcctccatagcctccaccgctgaagtttccggctgagacattctgttacgacggcaaggtgttcttcatgattaggttgacagacagggt |
1460229 |
T |
|
| Q |
118 |
tagggttggaagcgaatagcttttaaaagcaacaagaattagggtttcgataggcaaggtttacacttgaattgggttgggccgtatttca------cca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1460230 |
tagggttggaagcgaatagcttttaaaagcaacaagaattagggtttcgataggcaaggtttacacttgaattgggttgggccgtatttcaccaaatcca |
1460329 |
T |
|
| Q |
212 |
aatccaaatcaatcagttgtctttagaaaattattcatctc |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1460330 |
aatccaaatcaatcagttgtctttagaaaattattcatctc |
1460370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University