View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21242_low_96 (Length: 257)
Name: NF21242_low_96
Description: NF21242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21242_low_96 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 252
Target Start/End: Original strand, 18053440 - 18053675
Alignment:
| Q |
17 |
cattcgtctgttcgacaaaatgtggttttccactgacctaggggtccaatgtaatagacgtgtgtttccctaaattttagggaaagtttggtcagtgacg |
116 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18053440 |
cattcgtctgttcaacaaaatgtgtttttccacttacctaggggtccaatgtaatagacgtgtgttaacctaaattttagggaaagtttggtcagtgacg |
18053539 |
T |
 |
| Q |
117 |
cgagcctgttgctcgtgatatgaggtcaacaaaactgaatcccttgtcctgacactcagtatagtcacaatgttgggctcatagcttgcgaagcaaggta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18053540 |
cgagcctgttgctcgtgatatgaggtcaacaaaactgaatcccttgtcctgacactcagtatagtcacaatgttgggctcatagcttgcgaaccaaggta |
18053639 |
T |
 |
| Q |
217 |
gacaatggcaaacaccttgtatgattttcatctctc |
252 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
18053640 |
gacaatggcgaacaccttgtatgattttcatatctc |
18053675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University