View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21243_low_1 (Length: 488)
Name: NF21243_low_1
Description: NF21243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21243_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-113
Query Start/End: Original strand, 211 - 474
Target Start/End: Original strand, 14396411 - 14396664
Alignment:
| Q |
211 |
gctgctagtgcgagttatttggagtacttgatcagcagcagcacatgcaagcaaacatctatggaagatatcagaagttagtatttcatgtagtgtttcg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14396411 |
gctgctagtgcgagttatttggagtacttgatcagcagcagcacatgcaagcaaacatctatggaagatatcagaagttagtatttcatgtattgtttcg |
14396510 |
T |
|
| Q |
311 |
ggctccttcttcttggctcggcacacacattccaatactgtatggtataatataaagtaagtgtactaaatcttcgaatctttctatccggccaattatc |
410 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14396511 |
ggctccttcttctcggctcggcacacacattccaatact-----gtatagtataaagtaagtgtattaaatcttcgaatctttctatccggccaattatc |
14396605 |
T |
|
| Q |
411 |
aggaaatatagtctgcactatactatgtgctctgaaactcaaaacatctgtaacatcctcgccc |
474 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14396606 |
aggaaatatagtctgc-----actatgtgctctgaaactcaaaacatctgtaacatcctcgccc |
14396664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University