View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21243_low_7 (Length: 201)
Name: NF21243_low_7
Description: NF21243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21243_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 16 - 188
Target Start/End: Original strand, 33876119 - 33876291
Alignment:
| Q |
16 |
tggtgggtgatgggtgatgctgagtagacactggatatccaaattggcctttagttttagggattcgtgtgnnnnnnnggattttagattgagttcaatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33876119 |
tggtgggtgatgggtgatgctgagtagacactggatatccaaattggcctttagttttagggattcgtgtgtttttttggattttagattgagttcaatt |
33876218 |
T |
|
| Q |
116 |
caaggtgatggaaactgcttaagccttcattattgtagatgaccgaccccacatctcatttcagattcatgat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33876219 |
caaggtgatggaaactgcttaagccttcattattgtagatgaccgaccccacatctcatttcagattcatgat |
33876291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University