View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21244_low_2 (Length: 488)
Name: NF21244_low_2
Description: NF21244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21244_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 85 - 280
Target Start/End: Complemental strand, 34772023 - 34771828
Alignment:
| Q |
85 |
gctacttcatcaccagcttccctctcttcttgctgccatgacttttttggcttttcatgattttctttgcaagacaagcaccatccatcattataattgc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34772023 |
gctacttcatcaccagcttccctctcttcttgctgccatgacttttttggcttttcatgattttctttgcaagacaagcaccatccatcattataattgc |
34771924 |
T |
 |
| Q |
185 |
acaagcaggtcatctcatgtctttccctttcataagctgaaacaaaataagattaacaaaattataactcataacaaccaaccatcccagattctc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34771923 |
acaagcaggtcatctcatgtctttccctttcataagctgaaacaaaataagattaacaaaattataactcataacaaccaaccatcccagattctc |
34771828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 346 - 449
Target Start/End: Complemental strand, 34771760 - 34771657
Alignment:
| Q |
346 |
ggtaaaagtctatcaagtttggaaagatgtaatgtaacatgtagcatggttgaaatgaacatgatgaacatgaacatgatcatgaaatctaaacacattc |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34771760 |
ggtaaaagtctatcaagtttggaaagatgtaatgtaacatgtagcatggttgaaatgaacatgatgaacatgaacatgatcatgaaatctaaacacattc |
34771661 |
T |
 |
| Q |
446 |
caac |
449 |
Q |
| |
|
|||| |
|
|
| T |
34771660 |
caac |
34771657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University