View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21245_high_38 (Length: 281)
Name: NF21245_high_38
Description: NF21245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21245_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 26 - 209
Target Start/End: Original strand, 16627906 - 16628086
Alignment:
| Q |
26 |
ttagctgcatgaaattattatgttcatgtggtccaatctaactccagtactgtgtccatttatcacacatggtacgtggacgacatagcaaatggcaata |
125 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16627906 |
ttagctacatgaaattatt-tgttcatgtggtccaatctaactgcagtactgtgtccatttatcacacatggtacgtggacgacatagcaaatgacaata |
16628004 |
T |
 |
| Q |
126 |
atggcattgatataaagatacatataccgaaccttaatattatatcttttaataaaagatcgtaaacacttgaataaattacat |
209 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16628005 |
atggcattgatataaagatac--ataccgaaccttaatattatatcttttaataaaagagagtaaacacttgaataaattacat |
16628086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University