View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21245_low_35 (Length: 300)
Name: NF21245_low_35
Description: NF21245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21245_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 167 - 284
Target Start/End: Original strand, 2349843 - 2349960
Alignment:
| Q |
167 |
cttgtttggattgcaaggtggtatgacgaagaatttgacaagttaagctgtacaagtcaaaacatataaacaaacatttaagataaaaaggaaaacggaa |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2349843 |
cttgtttggattgcaaggtggtatgacgaagaatttgacaagttaagctgtacaagtcaaaatatataaacaaacatttaagataaaaaggaaaacggaa |
2349942 |
T |
 |
| Q |
267 |
aatttgtggcaggtttgt |
284 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2349943 |
aatttgtggcaggtttgt |
2349960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University