View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21245_low_36 (Length: 300)
Name: NF21245_low_36
Description: NF21245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21245_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 296
Target Start/End: Complemental strand, 42367439 - 42367173
Alignment:
| Q |
18 |
gaaatggtatatgcctgcgtgcaaaaaacaatgatattaattaataatgcatagtactatagtannnnnnnnnnnnnnnnnnnnnngttgtgttctgaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42367439 |
gaaatggtatatgcctgcgtgcaaaaaacaatgatattaattaataatgcatagtactatagtacatcatcatcatcatc------gttgtgttctgaat |
42367346 |
T |
 |
| Q |
118 |
cgcaagtattggaaaaagatcggtgaaagactcaaacaccaaatccctggggtaaacgaatcagaatcagaatcaaaatcaaagcagcaggttagcgatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42367345 |
cgcaagtattggaaaaagatcggtgaaagactcaaacaccaaatccctggggtaaacgaatcagaatca------aaatcaaagcagcaggttagcgatg |
42367252 |
T |
 |
| Q |
218 |
aaaggcgctttttcggcgcctggtgattacgttcacttcaagtctcaagttcctcttcacaaaattcccctatgctact |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
42367251 |
aaaggcgctttttcggcgcctggtgattacgttcacttcaagtctcaagttcctcttcacaaaattcccgtatgttact |
42367173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University