View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21245_low_37 (Length: 289)
Name: NF21245_low_37
Description: NF21245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21245_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 22 - 278
Target Start/End: Complemental strand, 14426469 - 14426212
Alignment:
| Q |
22 |
agtctattgctaggatgattgataagtctgtcggaggagatgtgtaaatcatgaaatccaaggaggaagaagctttagtc-tttgtcatgaagtcaacac |
120 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
14426469 |
agtctgttgctaggatgattgataagtctgtcggaggagatgtgtaaatcatgaaatccaaggaggaagaagctctagtcatttgtcatgaagtcaacac |
14426370 |
T |
|
| Q |
121 |
aactatttcctttgtgaagtgtgtgagtgatagatatgttcgagtcgaggttgataagatccttgatttcataaatcaaagtaccatatttgtggatcat |
220 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14426369 |
aactatttccttcgtgaagtgtgtgagtgatggatatgttccagtcgaggttgataagatccttgatttcataaatcaaagtagcatatttgtggatcat |
14426270 |
T |
|
| Q |
221 |
tgagaatgttaaaacattgaagagaatatgtaaataaaataacatcatggtggttcat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14426269 |
tgagaatgttaaaacattgaagagaatatgtaaataaaataacatcatggtggttcat |
14426212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University