View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21245_low_41 (Length: 277)
Name: NF21245_low_41
Description: NF21245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21245_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 23 - 192
Target Start/End: Complemental strand, 6705446 - 6705277
Alignment:
| Q |
23 |
cttatatataacatttatttatatatgattcatgtcaactattttaagctagtgcaatttaattagtttttgtgatgaatattcacttggattttcaaaa |
122 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6705446 |
cttatatataacatatatttatatatgattcatgtcaactattttaagctagtgcaatttaattagtttttgtgatgaatattcacttggattttcaata |
6705347 |
T |
|
| Q |
123 |
atataatgcagattgaaagaaccattcttgccacaaatacctaagaactatcttagaatcaagtaagtga |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6705346 |
atataatgcagattgaaagaaccattcttgccacaaatacctaagaactatcttagaattaagtaagtga |
6705277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University