View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21245_low_43 (Length: 259)
Name: NF21245_low_43
Description: NF21245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21245_low_43 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 12 - 259
Target Start/End: Original strand, 8252227 - 8252474
Alignment:
| Q |
12 |
agcacaaatataaactataaaccacaccttattacgattcaacaaagtcaacatatatcataatcattgtcctactaggaaaactgaattactagttggc |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8252227 |
agcataaatataaactataaaccacaccttataccgattcaacaaagtcaacatatatcataatcattgtcctactaggaaaactgaattactagttggc |
8252326 |
T |
 |
| Q |
112 |
tgcagatattaaatgcatgcaaatgcaatagattcatacagttattagctgcaatgtttggtaaagcactcattgcattttagctccattattacatgat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8252327 |
tgcagatattaaatgcatgcaaatgcaatagattcatacagttattagctgcaatgtttggtaaagcactcattgcattttagctccattattacatgat |
8252426 |
T |
 |
| Q |
212 |
ctcaagcataaataggctttacattttcttgtttccggtactaaccaa |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8252427 |
ctcaagcataaataggctttacattttcttgtttccggtactaaccaa |
8252474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University