View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21245_low_50 (Length: 250)
Name: NF21245_low_50
Description: NF21245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21245_low_50 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 37281511 - 37281273
Alignment:
| Q |
12 |
atgaaggtatgacatgatcttttaggatatttatggaagttaggttaatagaaaaaacctctcatagttttgtattaaattatttctctaaacagggctg |
111 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37281511 |
atgaaggtgtgacatgatcttttaggatatttatggaagctaggttaatagaaaaaaccactcatagttttgtattaaattatttctctaaacagggctg |
37281412 |
T |
 |
| Q |
112 |
tggttccccttcttcagggttatgaagatgctggagactttacagtgaaagcaagattaaggacaagcttacatggaaaccttgttttctatctgtctct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37281411 |
tggttccccttcttcagggttatgaagatgctggagactttacagtgaaagcaagattaaggacaagcttacatggaaaccttgttttctatctgtctct |
37281312 |
T |
 |
| Q |
212 |
tggttctgtggctctttttggattgatattactaataac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37281311 |
tggttctgtggctctttttggattgatattactaataac |
37281273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 37556312 - 37556257
Alignment:
| Q |
99 |
ctaaacagggctgtggttccccttcttcagggttatgaagatgctggagactttac |
154 |
Q |
| |
|
|||| ||||||||| || |||||| ||||||||| |||||||||||| |||||||| |
|
|
| T |
37556312 |
ctaagcagggctgtcgtgccccttattcagggttttgaagatgctggtgactttac |
37556257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 88 - 145
Target Start/End: Complemental strand, 39368611 - 39368554
Alignment:
| Q |
88 |
aaattatttctctaaacagggctgtggttccccttcttcagggttatgaagatgctgg |
145 |
Q |
| |
|
||||||||| |||| ||||||||||| |||||| ||||||||| |||||||||||| |
|
|
| T |
39368611 |
aaattattttcctaagcagggctgtggcaccccttattcagggttttgaagatgctgg |
39368554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University