View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21246_high_12 (Length: 204)
Name: NF21246_high_12
Description: NF21246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21246_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 50 - 194
Target Start/End: Original strand, 12370020 - 12370163
Alignment:
| Q |
50 |
ggagtagggctagggtttgttaaaagtagagnnnnnnnntgtgataaccctgcttgaattggagaggaagcaagcaaacacgtttgacaggatttggctg |
149 |
Q |
| |
|
||||||||| ||||||||||||||||| ||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12370020 |
ggagtagggttagggtttgttaaaagtggagaaaaaaa-tgtgataacactgcttgaattggggaggaagcaagcaaacacgtttgacaggatttggctg |
12370118 |
T |
|
| Q |
150 |
tacaacttgcatttggattcggacaattttggatattcttggaca |
194 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
12370119 |
tacagcttgcatttggattgggacaattttggatattattggaca |
12370163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 50 - 194
Target Start/End: Original strand, 3336123 - 3336265
Alignment:
| Q |
50 |
ggagtagggctagggtttgttaaaagtagagnnnnnnnntgtgataaccctgcttgaattggagaggaagcaagcaaacacgtttgacaggatttggctg |
149 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3336123 |
ggagtagagttagggtttgttaaaagtagagaaaaaa--tgtgataacactgcttgaattggggaggaagcaagcaaacgtgtttgacaggatttggctg |
3336220 |
T |
|
| Q |
150 |
tacaacttgcatttggattcggacaattttggatattcttggaca |
194 |
Q |
| |
|
| || |||||||||||||| ||||||||||| ||||| ||||||| |
|
|
| T |
3336221 |
tgcagcttgcatttggattgggacaattttgaatattattggaca |
3336265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University