View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21246_low_6 (Length: 366)
Name: NF21246_low_6
Description: NF21246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21246_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 1 - 364
Target Start/End: Original strand, 52423362 - 52423725
Alignment:
| Q |
1 |
tatttcgaaggggattcgtctctggtgttgcacagccttttgggtatctggactgcatggtggtggctatagtttgcatttctgggagtcacgcagtttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52423362 |
tatttcgaaggggattcgtctctggtgttgcacagccttttgggtatctggactgcatggtggtggctatagtttgcatttctgggagtcacgcagtttg |
52423461 |
T |
|
| Q |
101 |
tgcgttgcagtcatcgttatggagtttatttttcaggtcagtggctttttgctctgttgatgcctcatttcctggaccttgtactgttagttttagtctt |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52423462 |
tgcgttgcagtcatcgttgtggagtttatttttcaggtgagtggctttttgctctgttgatgcctcatttcgtggaccttgtactgttagttttagtctt |
52423561 |
T |
|
| Q |
201 |
aggactctgtgtggtgtgtttttgctaattatgtggcgtattgtgaaggagaggcagttgatgaatggtattcttcctcttctgttgtcagtagctttgt |
300 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52423562 |
aggactctgtgtggtgtgtctttgctaattatgtggcgtattgtgaaggagaggcagttggtgaatggtattcttcctcttctgttgtcagtagctttgt |
52423661 |
T |
|
| Q |
301 |
cttaaggtggatgcggtttctctgactatttgtgttttagagtctttgaatattcttggacatc |
364 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| || |||| |||| |
|
|
| T |
52423662 |
cttaaggtggatgcggtttctttgactatttgtgttttagagtctttgaatgttgttggtcatc |
52423725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University